Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Penaeus monodon E3 ubiquitin ligase TRIM50-like protein and application thereof

A technology of ubiquitin ligase and Penaeus monodon, which is applied in the direction of ligase, peptide/protein components, enzymes, etc., to reduce the amount of replication and improve the survival rate

Active Publication Date: 2021-06-11
SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no effective control and treatment for the outbreak of WSSV disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Penaeus monodon E3 ubiquitin ligase TRIM50-like protein and application thereof
  • Penaeus monodon E3 ubiquitin ligase TRIM50-like protein and application thereof
  • Penaeus monodon E3 ubiquitin ligase TRIM50-like protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Obtaining of Penaeus monodon E3 ubiquitin ligase TRIM50-like protein

[0035] (1) Extraction of total RNA

[0036] Take 50 mg of intestinal tissue of live and healthy Penaeus monodon, extract total RNA according to the instructions of the Qiagen Mini kit, and use DNase to digest and remove the genome.

[0037] (2) Preparation of full-length cDNA template

[0038] According to PrimeScript TM II 1st Strand cDNA Synthesis Kit (TaKaRa) manual to prepare full-length cDNA template, take 1 μg of total RNA, add 1 μL Oligo dT Primer (50 μM), 1 μL dNTP Mixture (10 mMeach), add RNase free ddH 2 O to make up to 10 μL. Mix the above solution, centrifuge briefly, and use a PCR instrument to keep the temperature at 65°C for 5 minutes, then take it out quickly, and cool it on ice to denature the template RNA. Add the following reagents sequentially: 4μL 5×PrimeScriptII Buffer, 0.5μL Inhibitor (40U / μL), 1μL PrimeScript II RTase (200U / μL) and RNasefree ddH 2 O. The follo...

Embodiment 2

[0063] Example 2 Preparation of TRIM50-like protein polyclonal antibody

[0064] Mix the above-mentioned purified TRIM50-like recombinant protein (about 100-200 μg) with 3 mL of complete Freund’s adjuvant and incubate it, and inject it into mice subcutaneously at multiple points, and inject 8 mice in total, each mouse is injected with about 50 μg of protein . Three weeks after the first injection, three booster immunizations were given. The booster dose is 10-20 μg protein, emulsified with incomplete Freund's adjuvant. The interval between each injection is 10 days. After the 4th injection, the mouse eyeballs were removed to take blood. After standing still at 37°C for 1 hour, the blood was centrifuged at 4000rpm for 10 minutes.

[0065] Such as image 3 As shown, the polyclonal antibody prepared above for the TRIM50-like protein of Penaeus monodon can specifically bind to the endogenous TRIM50-like protein of Penaeus monodon, and different tissues of three healthy shrimps...

Embodiment 3

[0066] Example 3 Interaction between TRIM50-like protein of Penaeus monodon and WSSV envelope protein and in vitro ubiquitination assay

[0067] (1) Interaction between TRIM50-like protein of Penaeus monodon and WSSV envelope protein

[0068] First, the prokaryotic expression strains were used to express and purify WSSV envelope proteins VP19 (GenBank accession No.DQ681071.1), VP24 (GenBank accession No. DQ196431.1), VP26 (GenBank accession No. AY220746.1) and VP28 (GenBank accession No.DQ681069.1)( figure 2 middle panels A-D). The specific implementation method of prokaryotic expression is as described in "Example 1 (3)", and the prokaryotic expression primers are respectively as follows:

[0069] VP19:

[0070] rVP19-F GAATTCATGGCCACCACGACTAACAC

[0071] rVP19-R CTCGAGTTAATCCCTGGTCCTGTTCTTAT

[0072] VP24:

[0073] rVP24-F GAATTCATGCACATGTGGGGGGTTTA

[0074] rVP24-R CTCGAGTTATTTTTTCCCCAACCTTAA

[0075] VP26:

[0076] rVP26-F GGATCCACACGTGTTGGAAGAAGCGT

[0077] rVP...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a prawn E3 ubiquitin ligase TRIM50-like protein and a gene coded by the prawn E3 ubiquitin ligase TRIM50-like protein. The invention also discloses an expression vector containing the gene, a recombinant protein and an antibody specifically bound with the prawn E3 ubiquitin ligase TRIM50-like protein. The invention further discloses application of the protein or the recombinant protein in preparation of prawn antiviral drugs or prawn immunity enhancing drugs. The invention also discloses a standard E3 ubiquitin ligase used as in-vitro ubiquitination detection, construction of an in-vitro ubiquitination detection system or kit, and identification and screening of E1 ubiquitin enzyme or E2 ubiquitin enzyme participating in the antiviral process in penaeus monodon.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a TRIM50-like protein of E3 ubiquitin ligase of Penaeus monodon and the application of the protein in anti-virus infection of prawns and detection of ubiquitination in vitro. Background technique [0002] Protein post-translational modification, such as phosphorylation, acetylation, and ubiquitination, is an important biological process that regulates many intracellular signals. Ubiquitination is one of the post-translational modifications that regulate cellular processes such as DNA repair, differentiation and immune response. Ubiquitination is the covalent attachment of a highly conserved 76 amino acid molecule, the ubiquitin molecule, to a substrate protein. The process of ubiquitination requires three enzymes, E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme and E3 ubiquitin ligase to complete activation, binding and ligation, respectively. The TRIM p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/00C12N15/52A61K38/53A61P31/20
CPCC12N9/93C12Y603/02019A61P31/20A61K38/53
Inventor 赵超邱丽华王鹏飞闫路路范嗣刚
Owner SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com