Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Milk-derived streptococcus salivarius for predicting infant obesity and separation method of milk-derived streptococcus salivarius

A technology of streptococcus salivarius and isolation method, which is applied in the field of milk-derived streptococcus salivarius and its isolation, can solve the problem of little research on breast milk

Pending Publication Date: 2021-06-25
SHANGHAI TENTH PEOPLES HOSPITAL
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Streptococcus salivarius is an important early-life colonizing bacterium, and its thermophilic subspecies is currently used in dairy fermentation and industrial production, with little research in human milk

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Milk-derived streptococcus salivarius for predicting infant obesity and separation method of milk-derived streptococcus salivarius
  • Milk-derived streptococcus salivarius for predicting infant obesity and separation method of milk-derived streptococcus salivarius

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] This example provides a method for isolating milk-derived Streptococcus salivarius SHDP5A1, wherein the preservation number of the milk-derived Streptococcus salivarius is CCTCC NO: M 2021060, the preservation date is January 14, 2021, and the preservation unit is China Typical culture preservation center, the address of the preservation unit is Wuhan University, Wuhan, China; the specific separation method is as follows:

[0026] Fresh breast milk sample diluted 10-10 3 After doubling, take 50-200 μl and spread it on a commercial KF Streptococcus agar plate, culture anaerobically at 37°C for 2-3 days, and select a single colony for identification. After identification, the 16S rRNA gene sequence of the strain is as follows:

[0027]AGGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTAGAACGCTGAAGAGAGGAGCTTGCTCTTCTTGGAAGAGTTGCGAACGGGTGAGTAACGCGTAGGTAACCTGCCTTGTAGCGGGGGATAACTATTGGAAACGATAGCTAATACCGCATAACAATGGGTGACCCATGTCATTCATTTGAAAGGGGCAACTGCTCCACTACAAGATGGACCTGCGTTGTATTAGCTAGTAGGTGAG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides milk-derived streptococcus salivarius for predicting infant obesity and a separation method of the milk-derived streptococcus salivarius. The milk-derived streptococcus salivarius is a streptococcus salivarius strain SHDP5A1, a 16SrRNA gene sequence of the milk-derived streptococcus salivarius strain is shown as SEQ ID NO: 1, the milk-derived streptococcus salivarius strain is classified and named as Streptococcus salivarius, the preservation number is CCTCCNO:M2021060, the preservation date is January 14, 2021, the preservation unit is China Center for Type Culture Collection, and the preservation unit address is Wuhan University, Wuhan, China. The milk-derived streptococcus salivarius for predicting the infant obesity, provided by the invention, serves as facultative anaerobic bacteria, is easy to colonize in intestinal tracts, and creates conditions for maturation and stabilization of intestinal flora in a later period, so that prediction of filial generation obesity can be realized through abundance detection of streptococcus salivarius in an early life period.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to a milk-derived streptococcus salivarius used for predicting obesity in infants and an isolation method thereof. Background technique [0002] Childhood obesity is currently a common metabolic disease in clinical practice, manifested by weight deviation from the normal growth curve in infancy. Increased prevalence of childhood obesity leads to increased prevalence of chronic diseases in adulthood, such as impaired glucose tolerance and hypertension. Therefore, it is very necessary to predict the obesity of infants after birth. [0003] The obesity of offspring is affected by both genetic factors and environmental factors. Genetic factors determine the genetic role of "obesity genes" through the discovery of certain genes (FTO genes), while environmental factors may have a more obvious effect on offspring obesity. It is also the most widely studied at present, such as diet, l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C12N1/02C12Q1/6883C12Q1/689C12Q1/14C12R1/46
CPCC12N1/20C12N1/02C12Q1/6883C12Q1/689
Inventor 杨蓉秦环龙黄林生毕德玺
Owner SHANGHAI TENTH PEOPLES HOSPITAL
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More