Human EGFR gene missense mutation molecular marker and application thereof in predicting drug resistance of targeted inhibitor

A molecular marker and inhibitor technology, applied in the fields of biomedicine and genetic testing, to achieve the effect of expanding the scope of application and accuracy

Active Publication Date: 2021-08-10
卫国朋
View PDF10 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are theoretically 3,572 missense mutants in the mutation hotspot region of EGFR (exon 18-21), and the drug sensitivity of most of the rare variants needs to be functionally annotated.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human EGFR gene missense mutation molecular marker and application thereof in predicting drug resistance of targeted inhibitor
  • Human EGFR gene missense mutation molecular marker and application thereof in predicting drug resistance of targeted inhibitor
  • Human EGFR gene missense mutation molecular marker and application thereof in predicting drug resistance of targeted inhibitor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0042] Example A Screening Method for Drug-Resistant Variation Molecular Markers

[0043] The screening method of the molecular markers comprises the following process ( figure 1 ):

[0044] S1, EGFR mutant library construction

[0045] For the construction method of EGFR missense mutant library, please refer to the patent application with application publication number CN112725331A (a construction method of high-throughput mutant library). In order to knock out endogenous EGFR in cells, two previously detected sgRNA expression modules targeting EGFR need to be cloned into the mutant library vector. Methods as below:

[0046] Endogenous EGFR knockout: use online software (http: / / chopchop.cbu.uib.no / ) to design 2 sgRNAs targeting EGFR gene. Related target sequences are as follows:

[0047] Target 1: GTTCACATCCATCTGGTACG TGG (TGG is the PAM sequence)

[0048] sgRNA1-oligo-F: CACC GTTCACATCCATCTGGTACG

[0049] sgRNA1-oligo-R: AAAA CGTACCAGATGGATGTGAAC

[0050] Targe...

example 1

[0073] Example 1 Drug susceptibility screening of mutant library using erlotinib

[0074] Erlotinib drug screening group operation method: In three 15cm plates, 15 million cells integrated with EGFR mutants (cells obtained in step S3) were planted, and 5 million cells were taken as zero-point untreated samples. Reserved for subsequent steps. Add 200 μL of erlotinib dissolved in DMSO to 3 plates, make RPMI 1640 medium (containing 10% fetal bovine serum, penicillin and streptomycin antibiotics, puromycin, blasticidin, GlutaMAX, all The final concentration of erlotinib purchased from ThermoFisher Company; the same below) was 600 nM. The cells were continuously cultured for 2 weeks and subcultured every 48 hours until the end of the experiment. Cells are counted during passage, and culture dishes of appropriate size (15cm, 10cm, or 6cm) are selected according to the number of cells to ensure that the cell culture density is not too high or too low. During the initial stage of s...

example 2

[0075] Example 2 Drug sensitivity screening of mutant library using gefitinib

[0076] The operation method of the gefitinib drug screening group: In three 15cm dishes, 15 million cells integrated with the EGFR mutant (cells obtained in step S3) were planted, and 5 million cells were taken as zero-point untreated samples. Reserved for subsequent steps. 200 μL of gefitinib dissolved in DMSO was added to each of the three plates so that the final concentration of gefitinib in the medium was 600 nM. The cells were continuously cultured for 2 weeks and subcultured every 48 hours until the end of the experiment. Cells are counted during passage, and culture dishes of appropriate size (15cm, 10cm, or 6cm) are selected according to the number of cells to ensure that the cell culture density is not too high or too low. During the initial stage of selection, a large number of cells died, and all cells were retained for each passage. As the screening time continues, the cells prolife...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedicine and gene detection, and particularly relates to a human EGFR gene missense mutation molecular marker and application thereof in predicting drug resistance of a targeted inhibitor. The molecular marker provided by the invention comprises 242 types of EGFR missense mutants related to the drug resistance of erlotinib, gefitinib and icotinib, and other 15 types of EGFR missense mutants related to the drug resistance of afatinib and osimertinib, and the mutants can be used for predicting the drug resistance of non-small cell lung cancer patients to targeted inhibitor treatment. According to the invention, a mutant library of EGFR gene tyrosine kinase functional regions is constructed by using a synthetic biology method, and the EGFR mutants are highly enriched in drug screening; the molecular marker can be clinically used as a potential molecular marker for predicting drug resistance of a lung cancer patient after the lung cancer patient is treated by a targeted inhibitor.

Description

technical field [0001] The invention belongs to the field of biomedicine and gene detection, and specifically relates to a human EGFR gene missense mutation molecular marker and its application in predicting drug resistance of targeted inhibitors. Background technique [0002] EGFR is a high-frequency mutated gene in lung cancer tissues. Interpretation of EGFR mutations is very important for early screening, precise drug use and prognosis monitoring of lung cancer. According to the 2020 World Cancer Statistics, the incidence and mortality of lung cancer rank the top two worldwide. Among them, the proportion of EGFR mutations in East Asian, female, and non-smoking lung cancer patients is as high as ~50%. The EGFR protein is located on the cell membrane and is an important part of the cell responsible for transmitting growth and proliferation signals. The EGFR protein has a tyrosine kinase domain in the inner part of the cell membrane, and mutations in this domain often lead...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6886C12Q1/6809
CPCC12Q1/6886C12Q1/6809C12Q2600/106C12Q2600/156C12Q2531/113C12Q2537/165
Inventor王跃强许红恩安磊吴光耀陈树清
Owner卫国朋