Human EGFR gene missense mutation molecular marker and application thereof in predicting drug resistance of targeted inhibitor
A molecular marker and inhibitor technology, applied in the fields of biomedicine and genetic testing, to achieve the effect of expanding the scope of application and accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0042] Example A Screening Method for Drug-Resistant Variation Molecular Markers
[0043] The screening method of the molecular markers comprises the following process ( figure 1 ):
[0044] S1, EGFR mutant library construction
[0045] For the construction method of EGFR missense mutant library, please refer to the patent application with application publication number CN112725331A (a construction method of high-throughput mutant library). In order to knock out endogenous EGFR in cells, two previously detected sgRNA expression modules targeting EGFR need to be cloned into the mutant library vector. Methods as below:
[0046] Endogenous EGFR knockout: use online software (http: / / chopchop.cbu.uib.no / ) to design 2 sgRNAs targeting EGFR gene. Related target sequences are as follows:
[0047] Target 1: GTTCACATCCATCTGGTACG TGG (TGG is the PAM sequence)
[0048] sgRNA1-oligo-F: CACC GTTCACATCCATCTGGTACG
[0049] sgRNA1-oligo-R: AAAA CGTACCAGATGGATGTGAAC
[0050] Targe...
example 1
[0073] Example 1 Drug susceptibility screening of mutant library using erlotinib
[0074] Erlotinib drug screening group operation method: In three 15cm plates, 15 million cells integrated with EGFR mutants (cells obtained in step S3) were planted, and 5 million cells were taken as zero-point untreated samples. Reserved for subsequent steps. Add 200 μL of erlotinib dissolved in DMSO to 3 plates, make RPMI 1640 medium (containing 10% fetal bovine serum, penicillin and streptomycin antibiotics, puromycin, blasticidin, GlutaMAX, all The final concentration of erlotinib purchased from ThermoFisher Company; the same below) was 600 nM. The cells were continuously cultured for 2 weeks and subcultured every 48 hours until the end of the experiment. Cells are counted during passage, and culture dishes of appropriate size (15cm, 10cm, or 6cm) are selected according to the number of cells to ensure that the cell culture density is not too high or too low. During the initial stage of s...
example 2
[0075] Example 2 Drug sensitivity screening of mutant library using gefitinib
[0076] The operation method of the gefitinib drug screening group: In three 15cm dishes, 15 million cells integrated with the EGFR mutant (cells obtained in step S3) were planted, and 5 million cells were taken as zero-point untreated samples. Reserved for subsequent steps. 200 μL of gefitinib dissolved in DMSO was added to each of the three plates so that the final concentration of gefitinib in the medium was 600 nM. The cells were continuously cultured for 2 weeks and subcultured every 48 hours until the end of the experiment. Cells are counted during passage, and culture dishes of appropriate size (15cm, 10cm, or 6cm) are selected according to the number of cells to ensure that the cell culture density is not too high or too low. During the initial stage of selection, a large number of cells died, and all cells were retained for each passage. As the screening time continues, the cells prolife...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



