Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker related to lung cancer proliferation and metastasis and application thereof

A lung cancer cell and lung cancer diagnosis technology, applied in the field of molecular markers, to achieve the effect of inhibiting the proliferation of lung cancer cells and increasing the expression level

Active Publication Date: 2021-08-24
CHINA AGRI UNIV
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report on the function of TMEM116 gene and its relationship with cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker related to lung cancer proliferation and metastasis and application thereof
  • Molecular marker related to lung cancer proliferation and metastasis and application thereof
  • Molecular marker related to lung cancer proliferation and metastasis and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Detection of TMEM116 Expression in Lung Cancer Tissues and Lung Cancer Cell Lines

[0033] By immunohistochemical technique, the expression of TMEM116 was firstly detected in lung tissue sections of lung cancer patients. The results showed that the expression of TMEM116 in cancer tissues was significantly higher than that in adjacent tissues ( figure 1 ). Firstly, the paraffin-embedded lung tissue was dewaxed with xylene and hydrated with gradient ethanol, and the tissue antigen was retrieved by microwave high pressure method, and the tissue section was antigen-blocked with serum dilution solution, and TMEM116, CC10, β- Tubulin, α-SMA antibody overnight. On the second day, anti-TMEM116 was used as the 546 red fluorescent secondary antibody, and anti-CC10, β-tubulin and α-SMA was used as the 488 green fluorescent secondary antibody. After incubation at room temperature for 1 hour, observation and photography were carried out through an Olympus microscope. Ex...

Embodiment 2

[0035] Example 2 Construction of TMEM116 knockdown human lung cancer cell line

[0036] By utilizing CRISPR / Cas9 technology, the TMEM116 gene was knocked down in the human A549 lung cancer cell line.

[0037] Using the tool website, several targets for TMEM116 were designed, and after further optimization and screening, three candidate targets were identified, namely target 1: acgggtgcgcttctacccag, target 2: gtatttcccagacagaatac and target 3: cataaagctgactaagccac. Subsequently, the target point was connected to the W2 vector, which contained the G418 drug screening gene, and the three vectors were transformed into A549 lung cancer cells by lipofection method. 48 hours after transfection, G418 drug screening was performed, and the screened cells were harvested 1 week later and DNA was extracted for sequencing detection. The sequencing results showed that the sequence of target 1 was more obvious and had more miscellaneous peaks ( image 3 ), it can be seen that target 1 has t...

Embodiment 3

[0039] Example 3 TMEM116 Knockout Cell Function Verification

[0040] By detecting the proliferation, colony formation, migration and invasion of lung cancer cells, it was found that the above functions of TMEM116 knockdown human lung cancer cells were significantly reduced, see Figure 5 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a molecular marker related to lung cancer proliferation and metastasis and application of the molecular marker. A gene editing technology CRISPR / Cas9 system is adopted, it is found that in a human lung cancer cell line, the TMEM116 gene is closely related to metastasis and proliferation of lung cancer, the TMEM116 gene knockout sgRNA is designed, and the lung cancer cell line with the TMEM116 gene knocked down is obtained through a lipid transfection method. On the basis, in-vitro and in-vivo experiments of mice find that the carcinogenic ability and the metastasis ability of TMEM116 knocked-down lung cancer cells are obviously reduced, the relationship between the TMEM116 gene and the lung cancer is clarified, the TMEM116 gene is found to be used as a molecular marker related to lung cancer proliferation and metastasis and used for diagnosis of the lung cancer, and a new method is provided for diagnosis and treatment of the lung cancer.

Description

technical field [0001] The invention relates to the field of medical molecular biology, in particular to the technical field of lung cancer diagnosis, and in particular to molecular markers related to proliferation and metastasis of lung cancer and applications thereof. Background technique [0002] Due to the stimulation of smoking, air pollution and some chemical factors, the normal lung cells of the human body are damaged, and gene mutations are prone to occur in the process of body damage repair, which in turn leads to the occurrence of tumors and cancers. Currently, lung cancer is also one of the most common malignancies, accounting for 18.4% of cancer deaths worldwide. Lung cancer is a highly complex tumor with a generally severe prognosis, with a 5-year survival rate of only 15%. In addition, under the promotion of metabolic changes and immune evasion, lung cancer cells can easily metastasize to other organs through blood vessels and lymphatic vessels, forming second...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12N15/113C12N15/63A61K45/00A61P35/04
CPCC12Q1/6886C12N15/113C12N15/63A61K45/00A61P35/04C12Q2600/106C12N2310/10
Inventor 邢怡明张苏红
Owner CHINA AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More