Preparation method of controllable release electrochemical DNA hydrogel composite material based on double-strand specific nuclease assistance
A composite material and hydrogel technology, applied in the field of biosensing, can solve problems such as tubal infertility, and achieve excellent response rate and sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Based on the preparation method of DSN-assisted controlled release electrochemical DNA hydrogel composite material, the steps are as follows:
[0028] (1) Mix SA or SB with 25% mass fraction of acrylamide solution, and vacuum dry for 15 minutes to remove oxygen. Then 10% mass fraction of freshly prepared APS and 10% mass fraction of TEMED were added and dried at 37 °C for 60 min to form P-SA or P-SB. Then, P-SA, P-SB, NE buffer and HRP were mixed and heated at 65 °C for 10 min with vigorous shaking to form a DNA hydrogel.
[0029] (2) DNA sequence in step (1) SA: Acrydite-AAAAACTTAGGGGCCGA C TAACCC, SB: Acrydite-AAAAGGGTTA C TCGGCC. During the synthesis of polymer P-SA or P-SB, the volume ratio of adding SA or SB, acrylamide solution, APS and TEMED is 80 μL: 16 μL: 1 μL: 1 μL. During the heating process of the DNA hydrogel composite material, the volume ratio of P-SA, P-SB, NE buffer and HRP is 2.5 μL: 2.5 μL: 1 μL: 1 μL. The unit of HRP enzyme activity is 100 M U. ...
Embodiment 2
[0031] Based on the DSN-assisted controllable release electrochemical DNA hydrogel composite material prepared in Example 1, the detection steps of target RNA are as follows:
[0032](1) Mix 20 μl target rRNA sequence or 20 μl blank buffer with 1 μl DSN respectively, and then add them to the DNA hydrogel prepared in step (1) of Example 1 to form a mixture. After incubating the mixture at 35°C for 60 minutes, shake it gently, take out 10 μl of supernatant, add it dropwise to the activated gold electrodes, and let it stand to dry. And take 10 μl of blank buffer solution and add it dropwise on the activated gold electrode, and let it stand to dry, as a blank control.
[0033] (2) In step (1), the target rRNA sequence is GGGUUAGUCGGCCCCUAAGU, the concentration is 10 pM, and the unit of DSN enzyme activity is 10 M U. The blank buffer is 1×PBS buffer.
[0034] (3) Immerse the gold electrodes prepared in step (1) into 1 ml TMB substrate solution (K-blue, Neogencorporation, containi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


