Sequencing joint, construction method, nano-hole library building kit and application

A technology for sequencing adapters and nanopores, which is used in biochemical equipment and methods, chemical libraries, and microbial determination/inspection.

Pending Publication Date: 2021-12-03
QITAN TECH LTD CHENGDU
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Purification processing steps will prolong library preparation time and reduce sequencing efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sequencing joint, construction method, nano-hole library building kit and application
  • Sequencing joint, construction method, nano-hole library building kit and application
  • Sequencing joint, construction method, nano-hole library building kit and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0090] (1) Design and synthesize the simulated joint top chain of the simulated joint top chain structure and the simulated joint bottom chain of the simulated joint bottom chain, wherein,

[0091] Simulate the adapter-top chain as adapter-top:

[0092] 5'- AATGTACTTCGTTCAGTTACGTATTGC -TCO-3';

[0093] The bottom chain of the simulated connector is adapter-bottom:

[0094] 5'-GCCG GCAATACGTAACTGAACGAAGTACATT GAGGCGAGCGGTCAAT-3'.

[0095] The annealing buffer was used to dissolve the synthesized simulated adapter top strand and simulated adapter bottom strand respectively to prepare 20uM stock solution A and stock solution B. Mix stock solution A and stock solution B in equal proportions and perform annealing treatment to obtain annealed products.

[0096] (2) According to the known sequence of the pUC19 plasmid, design a pair of primers with a product size of 228bp, wherein the 5' end of the upstream primer is appropriately modified as follows:

[0097]228-F: 5'-Tz-CGGC...

Embodiment 2

[0105] (1) Design and synthesize the joint top chain and the joint bottom chain, wherein,

[0106] The adapter top chain is adapter-top:

[0107] 5'-(iSpC3) 30 -GCGTG ACTAT CGGAC TCGTG GTC TTTTT TTTTT-(iSp18) 4 - GTCAG TTCGC TTCTT ACGCA -TCO-3';

[0108] The bottom chain of the connector is adapter-bottom:

[0109] 5'-GCCG TGCGT AAGAA GCGAA CTGAC AGTCC AGCAC CGACC T-3';

[0110] The annealing buffer was used to dissolve the synthesized adapter top strand and adapter bottom strand respectively to prepare 20 μM stock solution A and stock solution B, and stock solution A and stock solution B were mixed in equal proportions before annealing.

[0111] The T4 Dda helicase is loaded onto the Y adapter, resulting in a complex of enzyme and adapter. The sequence of T4 Dda helicase is shown in SEQ ID NO.1.

[0112] (2) According to the known sequence of phage (phage), design a pair of PCR amplification primers with a product of 502bp, and the upstream primers are modified a...

Embodiment 3

[0120] Refer to the scheme of Example 2 to prepare the test sequence connected with the sequencing adapter, the difference is that the Tco group in the top strand of the adapter is replaced by the DBCO group, and the Tz group in the upstream primer is replaced by the N3 group; And set up 3 control groups, in the 3 control groups, the mixture of annealed product and amplified product was left standing for 25min, 2hour and 6hour respectively, to verify the influence of different standing time on the connection rate of annealed product and amplified product.

[0121] The above products were detected by polyacrylamide gel electrophoresis. see Figure 9 to Figure 11 , Figure 9 It is the electrophoresis image of the product after standing for 25 minutes. Among them, the corresponding samples of the gel holes are as follows from left to right: maker; well 1-3: the mixture of annealed product and amplification product after standing for 25 minutes; hole 4: amplification product ; 5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sequencing joint, a construction method, a nano-hole library building kit and application. The sequencing joint comprises a joint top chain and a target connector. The joint top chain comprises a nano-hole guide chain and a first linking group which are arranged in a preset sequencing direction. The nano-hole guide chain is used for guiding a to-be-detected sequence to pass through a nano-hole sequencing channel. The target connector comprises a second linking group which is subjected to a click chemical reaction with the first linking group. The second linking group is used for being connected to the to-be-detected sequence. The sequencing joint can avoid the use of ligase, so that a purification treatment step before on-machine sequencing is omitted, the sequencing efficiency is improved, and template self-connection, artificial introduction of chimeric sequences and influence on structural variation analysis caused by the use of ligase can also be avoided.

Description

technical field [0001] The application belongs to the technical field of gene sequencing, and in particular relates to a sequencing linker, a construction method, a nanopore library construction kit and applications. Background technique [0002] In the prior art, regardless of second-generation high-throughput sequencing or nanopore sequencing, it is necessary to connect the sequencing linker and the sequence to be tested by DNA ligase during the library construction process, and then carry out sequencing on the machine. Compared with the second-generation sequencing platform in the prior art, the read length of the nanopore sequencing platform is longer, and the added DNA ligase will not only connect the sequencing adapter and the sequence to be tested, but also make some sequences to be tested self-ligated. Severely interfere with the analysis of subsequent sequencing sequences. After the sequencing adapter and the sequence to be tested are ligated by DNA ligase, purific...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C40B50/06C12Q1/6869
CPCC12N15/11C40B50/06C12Q1/6869C12Q2525/191C12Q2565/631C12Q2525/161
Inventor杨志刘艺赵多军李萍
OwnerQITAN TECH LTD CHENGDU