PcMINI vector as well as construction method and application thereof
A construction method and vector technology, applied in the field of molecular biology, can solve the problems affecting RNA splicing efficiency, low efficiency, poor accuracy, etc., and achieve the effects of efficient and rapid vector construction, simple operation and wide application range.
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1p
[0040] The construction of embodiment 1pcMINI vector
[0041] 1.1 Construction of recombinant intermediate vector pcDNA3.1-A
[0042] Using human genomic DNA as a template, use primers pcMINI-HindIII-F and pcMINI-KpnI-R to amplify the "exon A+intron A" DNA fragment; the sequences of the primers are as follows:
[0043] pcMINI-HindIII-F: ACTTAAGCTTatgagtgggctttggggtggccggtt (SEQ ID NO: 5)
[0044] pcMINI-KpnI-R: GCTCGGTACCtacccatgagccatgtg (SEQ ID NO: 6)
[0045] After the above PCR fragments were purified and recovered, the amplified fragments were digested with HindIII / KpnI, and the pcDNA3.1+ plasmid was digested with HindIII / KpnI; Transformed into Escherichia coli DH5α competent cells, and the positive clones screened for ampicillin resistance were double verified by colony PCR detection and sequencing detection, and the recombinant intermediate vector pcDNA3.1-A was obtained.
[0046] 1.2 Construction of pcMINI vector
[0047] Using human genomic DNA as a template, use ...
Embodiment 2
[0052] Example 2 Detection of abnormal mRNA splicing caused by c.1550_1551del mutation of human TSC1 gene
[0053] 2.1 Construction of pcMINI-TSC1 vector
[0054] The c.1550_1551del mutation of the TSC1 gene is located on the No. 15 exon of the TSC1 gene, which will contain part of the No. 14 intron (316bp), No. 15 exon (559bp) and part of the No. 15 intron (304bp) gene fragment Linked into the pcMINI vector to construct the expression plasmid, the map of the expression plasmid is as follows figure 2 shown.
[0055] For the TSC1 wild-type expression vector, using human genomic DNA as a template, use primers TSC1-37525-F / TSC1-39957-R and primers TSC1-37892-F / TSC1-39618-R to carry out nested PCR amplification; the primers The sequence is as follows:
[0056] TSC1-37525-F: gtattctgacttgactatatc (SEQ ID NO: 11)
[0057] TSC1-39957-R: ctgtgttgttagcttaacacag (SEQ ID NO: 12)
[0058] TSC1-37892-F: gtaatgtatgtgggattgctatg (SEQ ID NO: 13)
[0059] TSC1-39618-R: tccccaagcacctgtaa...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



