SNP molecular marker kasp-be-kl-sau2 linked to wheat grain length major QTL and its application
A kasp-be-kl-sau2, molecular marker technology, applied in the field of crop molecular genetics and breeding, can solve the problem of not many molecular markers, and achieve the effects of accurate and efficient detection, convenient and stable amplification, and high success rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 Acquisition of wheat grain length QTL Qkl.sau-BE-4A and its molecular marker KASP-BE-kl-sau2
[0044] (1) Using the wheat line '99E18' as the female parent and the wheat variety 'BLS1' as the male parent, hybrid F1 was obtained, F1 generation was selfed to obtain F2, and the single seed method was used in F2 to propagate to the F3 generation, and the hybrid F1 was obtained. The recombinant inbred lines of 238 individual plants constituted the genetic mapping population.
[0045] (2) Grain length phenotype identification of the F3 population: The F3 population lines were harvested, threshed, dried and phenotypic identification of the grain characters at the maturity stage of wheat. The average value was obtained, representing the grain length of the line.
[0046] (3) Using the mixed population segregation analysis (BSA), two parental pools were constructed, and two groups of lines with 30 extreme grain length differences were selected in the F3 population to ...
Embodiment 2
[0066] Example 2 Application of molecular marker KASP-BE-kl-sau2 in selection and control of grain length QTL Qkl.sau-BE-4A
[0067] (1) Using the common wheat line 'BLS1' with longer grain length as the male parent and the common wheat line 'Sumai3' as the female parent to construct F 3 population, 183 lines were selected among the progeny lines.
[0068] (2) KASP-BE-kl-sau2 marker detection was performed on the obtained 183 strains, and the specific method was as follows: DNA of 183 strains was extracted; Specific primer pairs are primers for PCR amplification and fluorescence reading, and the primers are:
[0069] Primer on FAM tag: (the underlined part is the FAM tag sequence) 5'- GAAGGTGACCAAGTTCATGCT CCAGCCGGCAGGTGGAATGCC-3' (SEQ ID NO: 4)
[0070] Primer on HEX tag: (the underlined part is the HEX tag sequence) 5'- GAAGGTCGGAGTCAACGGATT CCAGCCGGCAGGTGGAATGCT-3' (SEQ ID NO: 5)
[0071] Universal downstream primer: 5'-AAGGGGAAGGTCAGCTGCTG-3' (SEQ ID NO:6)
[0072]...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com