Method for detecting bactrocera scutelata hendel based on visual LAMP (loop-mediated isothermal amplification) technology and application

A technology for detecting fruit flies, which is applied in the field of fruit fly detection based on visual LAMP technology, can solve the problems that fruit flies cannot be detected, and achieve the effects of avoiding aerosol pollution, high sensitivity, and simple result detection

Pending Publication Date: 2021-12-21
QINGDAO AGRI UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although a Chinese patent application with the application number 201711141240.3 discloses a rapid and visual molecular detection method for B. melon flies, this patent uses LAMP technology to identify B. melon flies and cannot be used for detection of B.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting bactrocera scutelata hendel based on visual LAMP (loop-mediated isothermal amplification) technology and application
  • Method for detecting bactrocera scutelata hendel based on visual LAMP (loop-mediated isothermal amplification) technology and application
  • Method for detecting bactrocera scutelata hendel based on visual LAMP (loop-mediated isothermal amplification) technology and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Primer Design

[0030] Based on a 633bp fragment (SEQ ID NO: 1) on the mitochondrial COI gene of Ceratitis cerevisiae. The sequence is as follows:

[0031] SEQ ID NO: 1:

[0032]TGAGCAGGTATAGTAGGAACATCTTTAAGAATTTTAGTCCGAGCAGAATTGGGTCACCCAGGAGCTCTAATTGGAGACGACCAAATTTATAATGTAATCGTAACAGCTCATGCATTTGTAATAATTTTTTTCATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATACTCGGAGCCCCAGATATAGCCTTCCCACGAATAAATAATATAAGATTTTGACTACTGCCCCCTTCACTTACACTACTTTTAGTGAGCAGTATAGTAGAAAATGGGGCTGGAACAGGTTGAACTGTTTACCCTCCTCTTTCATCAATTATTGCTCATGGAGGAGCATCTGTTGATCTAGCTATTTTCTCTTTACATTTAGCCGGAATTTCCTCTATTTTAGGTGCAGTAAATTTTATTACAACAGTAATCAATATACGATCTACAGGAATTACCTTCGATCGAATACCTTTATTTGTCTGAGCAGTAGTATTAACAGCCCTATTACTACTACTTTCATTACCTGTTTTAGCTGGAGCTATTACAATGCTATTAACAGATCGAAATTTAAACACCTCTTTCTTTGACCCAGCCGGAGGTGGAGACCCCATTCTATATCAACACTTATTC

[0033] View the sequences of Bactrocera scutellata at the same position as Bactroceradorsalis, Bactrocera carambolae, Bactrocera jarvisi, Bactroceratau and Bac...

Embodiment 2

[0043] The specific detection of embodiment 2 primers

[0044] Configure the LAMP reaction solution of Bacteria cerevisiae according to the following composition:

[0045] Reaction solution A: 10×ThermoPol buffer, MgSO 4 (100mmol / L), dNTP mixture (10mmol / L), Betaine (5mol / L), Bst DNA large fragment polymerase (8U / uL), 2 pairs of primer sequences F3 nucleic acid sequence as shown in SEQ ID No.2, The nucleic acid sequence of B3 is shown in SEQ ID No.3, the nucleic acid sequence of FIP is shown in SEQ ID No.4, and the nucleic acid sequence of BIP is shown in SEQ ID No.5.

[0046] Reaction solution B: 10000×SYBR Green I

[0047] The system composition of reaction solution A is:

[0048]

[0049] a) Preparation of Ceratitis cerevisiae DNA template

[0050] Take the whole body or part of the tissue samples of the insects to be tested, use the DNeasy Blood & Tissue kit (QIAGEN), and refer to the instructions of the kit to extract genomic DNA.

[0051] b) LAMP test results

...

Embodiment 3

[0055] Embodiment 3 Sensitivity detection

[0056] Use an ultra-micro-volume ultraviolet spectrophotometer (Nano-200) to detect the initial concentration of the B. cerevisiae DNA template, take 1 μL template and add 9 μL ddH 2 O carry out 10-fold serial dilution, and the selected dilutions are: 1ng / μL, 1×10 -1 ng / μL, 1×10 -2 ng / μL, 1×10 -3 ng / μL, 1×10 -4 ng / μL, 1×10 -5 ng / μL and 1×10 -6 ng / μL. Add DNA template ul of different concentrations above to reaction solution A, mix well, inactivate at 63°C for 40min, and 85°C for 5min. After the reaction, centrifuge with a palm centrifuge to allow the nucleic acid dye to mix into the system. The results show that the minimum detection concentration of this method can reach 1×10 -6 ng / μL. like Figure 5 As indicated, the detected DNA template concentrations were 1 ng / μL, 1×10 -1 ng / μL, 1×10 -2 ng / μL, 1×10 -3 ng / μL, 1×10 -4 ng / μL, 1×10 -5 ng / μL and 1×10 -6 ng / μL. in 1×10 -6 The fluorescence intensity can still be disti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for detecting bactrocera scutelata hendel based on a visual LAMP (loop-mediated isothermal amplification) technology. The method comprises the steps of: 1, designing a specific LAMP primer group by taking a section containing a specific site in a mitochondrial COI gene of the bactrocera scutelata hendel as a target gene; 2, performing an LAMP reaction by using the specific LAMP primer group and taking the whole genome DNA of a sample to be detected as a substrate; and 3, after the LAMP reaction is finished, judging whether the sample to be detected is the bactrocera scutelata hendel or not according to a color development result of a nucleic acid dye for detection. The invention further provides a corresponding primer combination and application thereof. The method and the primer group provided by the invention can be used for rapidly and accurately detecting the bactrocera scutelata hendel and distinguishing the bactrocera scutelata hendel from other types of tephritidae very close to the bactrocera scutelata hendel, have high sensitivity and can be used for visual and rapid detection on a detected material in biological quarantine.

Description

technical field [0001] The invention relates to the technical field of biological quarantine, in particular to a method and application for detecting Bactrocera cerevisiae based on a visual LAMP technology. Background technique [0002] The fruit fly Bactrocera scutellata Hendel belongs to Diptera (Diptera) Tephritidae (Tephritidae), mainly distributed in East Asia and Southeast Asia. The main quarantine pests. In recent years, with the global warming and the large-scale interactive transportation of domestic fruits and vegetables, the occurrence area of ​​Bacterophora spp. in my country has gradually expanded, and the degree of harm has continued to intensify. In Henan, Shandong, Shaanxi, Anhui and other provinces, Bactrocera has become one of the main local fruit and vegetable pests. The widespread occurrence of Bactrocera not only caused serious economic losses to the fruit and vegetable industry, but also may have adverse effects on the export quarantine of fruits and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/6844C12N15/11
CPCC12Q1/6888C12Q1/6844C12Q2531/119C12Q2563/107
Inventor董兆克褚栋刘利君
OwnerQINGDAO AGRI UNIV