Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of protein GEN1 and related biological materials thereof in regulation and control of corn yield

A yield and corn technology, applied in the field of plant biology, can solve problems such as the inability to accurately evaluate the impact of yield

Active Publication Date: 2022-01-28
CHINA AGRI UNIV
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the previous studies, the research on pollen fertility was basically based on mutants that showed complete abortion. are very meaningful, but neither can accurately assess its impact on yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of protein GEN1 and related biological materials thereof in regulation and control of corn yield
  • Application of protein GEN1 and related biological materials thereof in regulation and control of corn yield
  • Application of protein GEN1 and related biological materials thereof in regulation and control of corn yield

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1, SNP site mining of GEN1A

[0059] Using an associative population composed of 324 maize inbred lines with extensive variation, sowing in Hainan in 2015, sowing 10 seeds in each row, three plots were repeated, after the maize tassels came out and before the start of loose powder, in a single row of the same family Select three single plants with relatively uniform growth, and take 2 pairs of small flower spikes at half of the spindle tassel of each single plant, and take a total of 6 pairs of small flower spikes for each family, and store them in 2ml of FAA fixative. in a centrifuge tube.

[0060] Mix 10 anthers from different plants of the same family in the above-mentioned florets fixed with FAA fixative, put them into a 2ml centrifuge tube containing 0.9ml of pure water and a small glass bead, and shake and break through the proofer (1200rpm , 2 minutes), the anther wall ruptured, and the pollen grains fully entered the solution. Add preheated 1ml 0.2% aga...

Embodiment 2

[0067] Embodiment 2, the application of SNP_2057 in detecting pollen fertility

[0068] According to the detection method in embodiment 1 to the inbred material in table 1 (the inbred material in table 1 is recorded in Yang X, Gao S, Xu S, Zhang Z, Prasanna BM, Lin L, Li J, Yan J (2011) Characterization of aglobal germplasm collection and its potential utilization for analysis of complex quantitative traits in maize. Molecular Breeding 28: 511-526) for pollen fertility detection, the genotype of the inbred line material SNP_2057 site in Table 1 is passed MaizeSNP50 Beadchip (Illumina) was used for detection.

[0069] The SNP_2057 site can also be amplified by PCR and sequenced to detect the SNP genotype of inbred lines. The detection method is as follows.

[0070] SNP genotyping primers:

[0071] GEN1A-SNP-F: GTGCAGTTATTTGATGAGGATG (SEQ ID No. 9);

[0072] GEN1A-SNP-R: CTGGTGTTACTACTAACCTAC (SEQ ID No. 10).

[0073] The left primer GEN1A-SNP-F and the right primer GEN1A-S...

Embodiment 3

[0077] Example 3. Verification of GEN1 gene function using mutants with W22 background

[0078] Both the UFMu-07233 homozygous mutant and the UFMu-03630 homozygous mutant are provided by the maize genome public database (www.maizeGDB.org). Exon Unifrom Mu insertion mutant, UFMu-03630 is a Unifrom Mu insertion mutant located in the first exon of the GEN1B gene based on the maize W22 inbred line.

[0079] Wild-type W22 materials were used as recurrent parents, and UFMu-07233 homozygous mutants and UFMu-03630 homozygous mutants obtained from the maize genome public database were used as donor parents. The tassel pollen of W22 was collected during the pollination period, and artificially The ears of the obtained UFMu-07233 homozygous mutant and UFMu-03630 homozygous mutant were pollinated separately to obtain BC1F1 material; then the BC1F1 material was sown, and the tassel pollen of W22 was collected during the pollination period, and the ear of BC1F1 material was artificially pol...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a protein GEN1 and related biological materials thereof in regulation and control of corn yield. The protein GEN1 is any one of the following proteins: (a1) a protein with an amino acid sequence as shown in SEQ ID No.3 or SEQ ID No.6, and (a2) a protein with an amino acid sequence as shown in SEQ ID No.3 or SEQ ID No.6; and (a2) a protein which is obtained by substitution and / or deletion and / or addition of one or more amino acid residues on the amino acid sequence as shown in SEQ ID No.3 or SEQ ID No.6 and has the same function. The protein GEN1 can be used for regulating and controlling plant yield, regulating and controlling plant pollen fertility or being used for plant breeding.

Description

technical field [0001] The invention relates to the field of plant biotechnology, in particular to the application of protein GEN1 and related biological materials in regulating corn yield. Background technique [0002] Corn (Zea mays) is one of the three major food crops in the world, and it is also an important source of feed. It is a very important grass crop in agricultural production. Maize is the most unique crop with strong male inflorescences among the major cultivated crops. Due to the characteristics of crop traits such as monoeciousness, wind pollination, and natural selection for long-term survival competition, maize has far more pollen than is required for normal pollination. The pollen finally formed by the development of maize male germ cells is a "pool" formed by the transformation of photosynthetic primary products. The production process requires a large amount of photosynthetic energy consumption, and the photosynthetic energy consumption will have an impa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/113C07K14/415C12Q1/6895A01H5/10A01H6/46
CPCC12N15/8218C12N15/8261C12N15/8289C07K14/415C12Q1/6895C12N2310/20C12Q2600/13C12Q2600/156C12Q2600/172
Inventor 贺岩郭婷姜露光李波罗金红王淄姜欢
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com