Method for efficiently constructing sgRNAs plasmid library
A plasmid and library technology, applied in the field of gene editing, can solve the problems of low transformation efficiency, impact of electric shock transformation efficiency, limited quality of sgRNAs plasmid library, etc., and achieve the effect of reducing workload
Pending Publication Date: 2022-01-28
EDIGENE THERAPEUTICS (BEIJING) INC
View PDF5 Cites 0 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Among them, the chemical transformation construction method will bring a huge workload to the construction of sgRNAs plasmid library due to low conversion efficiency, and the quality of sgRNAs plasmid library is limited. Measured from its sgRNAs loss rate, gene loss rate and the overall distribution of sgRNAs, the quality of sgRNAs plasmid library Both need to be improved
Although the electric shock transformation construction method can theoretically make up for the shortcomings of the chemical transformation construction method, the regulation of the experimental conditions in the electric shock transformation construction has a greater impact on the electric shock transformation efficiency.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment
[0045] 1. Enzyme Ligation Reaction
[0046] 1.1 sgRNA sequence synthesis:
[0047] The sgRNA sequence is synthesized through the invitrogen primer synthesis platform through outsourcing services. The synthesized sgRNA sequence has a structure such as figure 1 As shown, the synthetic sequence includes primers for amplification, BsmBI restriction site and 20bp sgRNA sequence. The specific synthetic sequence is shown in SEQ ID NO: 1: TTGTGGAAAGGACGAAACCGTCTCAACCGGACCTGTGCTGACACCACAGGTTTTGAGACGTAGAGCTAGAGACAGCA.
[0048] Sequence amplification:
[0049] 1.2.1 After diluting the above synthetic sequence to 10uM with deionized water, as a template for sgRNA amplification, mix 5×Phusion HF Buffer (Thermo, #M0530L), 2.5 mM dNTP (full gold, #AD101) as shown in Table 1 -01), 10 μM forward primer (Invitrogen), 10 μM reverse primer (Invitrogen) (Table 2), sgRNA amplification template (Invitrogen), Phusion DNA Polymerase (Thermo, #M0530L) and deionized water (Invitrogen, #10977015) for ...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
Login to View More
Abstract
The invention relates to a method for efficiently constructing an sgRNAs plasmid library and the sgRNAs plasmid library prepared by the method. The method comprises the following steps: 1) synthesizing and amplifying an sgRNA sequence; 2) inserting the sgRNA sequence into a plasmid vector through enzyme digestion connection; 3) transforming the plasmid vector containing the sgRNA sequence obtained in the step 2) into competent cells through electric shock; and 4) performing multiplication culture. According to the invention, the key parameters involved in the electric shock transformation library building process are subjected to cross combination, the workload during library building is remarkably reduced by evaluating the electric shock transformation efficiency, the library quality and the like, and a stable and efficient method is provided for sgRNA plasmid library building.
Description
technical field [0001] The present invention relates to gene editing technology, more specifically to a method for efficiently constructing sgRNAs plasmid library. Background technique [0002] Gene editing technology enables humans to "edit" target genes at a fixed point, thereby realizing the modification of specific DNA fragments in the genome of an organism. The CRISPR-Cas system is an acquired immune system of prokaryotes. The guide RNAs (gRNAs) transcribed by repeat spacers help Cas proteins to recognize and cut foreign pathogenic RNAs. The CRISPR-Cas9 system is currently a widely used gene editing tool in eukaryotes, which can accurately and efficiently edit targeted genes. At the same time, the CRISPR-Cas9 system has also been widely used in the screening of high-throughput drug targets. In high-throughput screening applications, guide RNA sequences (sgRNAs) are designed for multiple targeted genes, and inserted into expression vectors by enzyme-cut ligation to for...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More Patent Type & Authority Applications(China)
IPC IPC(8): C40B50/06C40B40/06C12N15/113
CPCC40B50/06C40B40/06C12N15/113C12N2310/10C12N2310/20
Inventor 金鸣袁鹏飞
Owner EDIGENE THERAPEUTICS (BEIJING) INC