Bacterial genome multi-editing method based on double-stranded DNA recombinant engineering and application thereof

A DNA recombination and genome technology, applied in genetic engineering, recombinant DNA technology, DNA/RNA fragments, etc., can solve the problems of establishment of multiple genome editing methods, low efficiency, low editing efficiency, etc., to achieve low cost of substrate preparation, enhanced Strain optimization, the effect of unlimited length of inserted gene

Pending Publication Date: 2022-02-25
SHANDONG UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Taken together, the characteristics of dsDNA recombination engineering make it a potential tool to mediate replacements, deletions, and insertions in multiple regions of the genome, whereas ssDNA recombination engineering is inefficient in this regard
However, perhaps due to the low editing efficiency, so far no multiple genome editing method based on dsDNA recombination engineering has been established in E. coli

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacterial genome multi-editing method based on double-stranded DNA recombinant engineering and application thereof
  • Bacterial genome multi-editing method based on double-stranded DNA recombinant engineering and application thereof
  • Bacterial genome multi-editing method based on double-stranded DNA recombinant engineering and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Embodiment 1: A dsDNA-recombineering assisted Multiplex Genome Editing (dReaMGE) method applicable to a variety of bacteria provided by the present invention, the specific implementation steps are as follows:

[0070] (1) Select Red / ET type recombinase that can effectively mediate recombineering for different hosts, suitable inducible promoters, strong promoters, resistance markers and backbone plasmids; wherein, the hosts include Escherichia coli E.coliGB2005, primary Five different bacteria including Polyangium brachysporum DSM 7029, Burkholderia Paraburkholderia.megapolitana DSM 23488, Pseudomonas.putida KT2440 and Pseudomonas.syringae DC3000.

[0071] (2) Use the inducible promoter screened in (1) to control the recombinase and construct it on a suitable backbone plasmid, and convert the constructed gene into The recombinant enzyme expression plasmid is introduced into the host cell.

[0072] (3) A dsDNA substrate with short homology arms (100 bp) capable of anchor...

Embodiment 2

[0080] Example 2: dsDNA-mediated simultaneous editing of dual regions of the E.coli genome

[0081] In Escherichia coli GB2005, it was verified that the dsDNA recombineering of the present invention mediates the simultaneous editing of two genome regions at different recovery times and different recovery temperatures.

[0082] Primer sequence: the lowercase part is used to mediate sufficient homology arms, and the uppercase part is the primer for amplifying the resistance gene.

[0083] Pgenta-nrdAB-DH10B-3: gcagtccttctgccgCccaatccagaacgcgatgGattttgtcgagattgatgcg ctctgtgctaccgtcgcgctttgtcaccagcagattctgattcatATGTATATCTCTTTAGGTG;

[0084] P genta -nrdAB-DH10B-5: tcgcttatatattgaccacaactgatacatcagattatgtgatgactcgtgcttagatca atttttgcaatcattagcaaaaagattaataagccatctaAGGCACGAACCCAGTTGACA;

[0085] GB2005-regionA-delet-3: tgcacttcctgccggatatctacgtgccgtgcgaccagtgcaaaggtaaacgc tataaccgtgaaacgctggagattaagtacaaaggcaaaaccatccaTTACGCCCCGCCCTGCCACT;

[0086] GB2005-regionA-delet-5: gctgcca...

Embodiment 3

[0095] Embodiment three: Six regions are replaced simultaneously in Escherichia coli GB2005

[0096] This example tests dsDNA recombineering in wild-type E.coli GB2005 and GB2005-P genta -In nrdAB, the ability to mediate the simultaneous replacement of six regions of the genome (0.5kb) under the condition of adding / not adding dNTPs, such as figure 2 a.

[0097] Primer sequence:

[0098] GB2005-regionC-delet-3: attgaagcagaagcctgcgatgtcggtttccgcgaggtgcggattgaaaatggt ctgctgctgctgaacggcaagccgttgctgattcgaggcgttaaccTTACGCCCCGCCCTGCCACT;

[0099] GB2005-regionC-delet-5: gccagctggcagttcaggccaatccgcgccggatgcggtgtatcgctcgccactt caacatcaacggtaatcgccatttgaccactaccatcaatccggtCGTTGATCGGCACGTAAGAG;

[0100] GB2005-regionD-delet-3: cgcctaatacatctacactttctatttattgacaagtgatacgttgcaaaaggagcaacacccccacagactcgatgactgcgcagtcatacagtgaaattTTACGCCCCGCCCTGCCACT;

[0101] GB2005-regionD-delet-5: taggaatttcggacgcgggttcaactcccgccagctccaccaaaattctccatcgg tgattaccagagtcatccgatgaagtcctaagagcccgcacggcCGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of engineering, and particularly relates to a bacterial genome multi-editing method and application thereof. The bacterial genome multi-editing method based on double-stranded DNA recombinant engineering comprises the following steps: (1) mixing dsDNA substrates targeting different target sequences, and introducing the mixed dsDNA substrates into host competent cells with recombinase plasmids; (2) recovering the competent cells at the temperature lower than the optimum growth temperature; dNTPs with the final concentration of 10 nM is added in the resuscitation process; and (3) screening out a single colony with a marker from the recovered competent cells, and identifying. The method has the advantages that the substrate preparation cost is low, the length of the inserted gene is not limited, the method is not dependent on double-stranded DNA breakage, a plurality of guide RNA expression vectors do not need to be constructed, and a restrictive repair system of host bacteria does not need to be inactivated.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a bacterial genome multiple editing method and its application. Background technique [0002] The analysis and editing of bacterial genomes are key to basic and applied biology research. Precise and efficient genome editing technologies are needed to better understand the genetic basis of traits and to develop highly engineered microbial cell factories to harvest valuable substances. Multiplex genome editing enables simultaneous modification of multiple genomic loci, greatly facilitating the creation of genomic diversity and accelerating directed evolution. Multiplex genome editing requires precise and efficient genome editing technologies to better understand the genetic basis of traits and to develop highly engineered microbial cell factories to harvest valuable substances. Two key technologies, CRISPR-Cas system and single-stranded DNA (single-strande...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/70C12N15/74C12N15/78
CPCC12N15/113C12N15/70C12N15/74C12N15/78C12N2800/101C12N2310/20
Inventor卞小莹王雪郑文韬涂强张友明
OwnerSHANDONG UNIV