Preparation and application of mesenchymal stem cell exosome for delivering RNA (Ribonucleic Acid) medicine at targeted damaged part
A technology of stem cells and exosomes, applied in the field of biomedicine, can solve problems such as poor safety and low delivery efficiency, and achieve the effect of reducing expression and promoting apoptosis of cancer cells
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] This embodiment provides a method for preparing stem cell exosomes targeting tumor sites to deliver gene drugs, which specifically includes the following steps:
[0063] (1) Construction of overexpression plasmid:
[0064] S101, design PCR amplification fragment primers, and introduce the homologous sequence at the end of the linearized cloning vector at the 5' end of the primer, so that the 5' and 3' most end sequences of the amplification product are completely consistent with the sequences at both ends of the linearized cloning vector respectively.
[0065] And send the company to synthesize primers. The primer sequences of PCR amplified fragments are as follows:
[0066] Primer-F (SEQ ID NO. 1):
[0067] CGCGAATTCGAAGTATACCTCGAGGCCACCATGGAGG
[0068] Primer-R (SEQ ID NO. 2):
[0069] CGATCGCAGATCCTTGGATCCTTAGCTGGAGTGAAAACTTGAAGACTCAGA
[0070] S102, the plasmid containing the PGMLV-CMV-MCS-EF1-ZsGreen1-T2A-puro vector ( figure 1 The bacterial solution of the ...
Embodiment 2
[0093] This embodiment provides a method for preparing stem cell exosomes targeting tumor sites to deliver gene drugs, which specifically includes the following steps:
[0094] (1) Construction of overexpression plasmid:
[0095] S101, design PCR amplification fragment primers, and introduce the homologous sequence at the end of the linearized cloning vector at the 5' end of the primer, so that the 5' and 3' most end sequences of the amplification product are completely consistent with the sequences at both ends of the linearized cloning vector respectively. And send the company to synthesize primers. The primer sequences of PCR amplified fragments are shown in SEQ ID NO.1 and SEQ ID NO.2.
[0096] S102, culture the bacterial solution containing the PGMLV-CMV-MCS-EF1-ZsGreen1-T2A-puro vector plasmid overnight, and take 5 ml of fresh bacterial solution to extract the vector plasmid using a plasmid mini-extraction kit.
[0097] S103, mix 1 μg vector plasmid, 3 μL green buffer,...
Embodiment 3
[0119] This embodiment provides a method for preparing stem cell exosomes targeting tumor sites to deliver gene drugs, which specifically includes the following steps:
[0120] (1) Construction of overexpression plasmid:
[0121]S101, design PCR amplification fragment primers, and introduce the homologous sequence at the end of the linearized cloning vector at the 5' end of the primer, so that the 5' and 3' most end sequences of the amplification product are completely consistent with the sequences at both ends of the linearized cloning vector respectively. And send the company to synthesize primers. The primer sequences of PCR amplified fragments are shown in SEQ ID NO.1 and SEQ ID NO.2.
[0122] S102, culture the bacterial solution containing the PGMLV-CMV-MCS-EF1-ZsGreen1-T2A-puro vector plasmid overnight, and take 5 ml of fresh bacterial solution to extract the vector plasmid using a plasmid mini-extraction kit.
[0123] S103, mix 1 μg vector plasmid, 3 μL green buffer, ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap