Preparation and application of mesenchymal stem cell exosome for delivering RNA (Ribonucleic Acid) medicine at targeted damaged part

A technology of stem cells and exosomes, applied in the field of biomedicine, can solve problems such as poor safety and low delivery efficiency, and achieve the effect of reducing expression and promoting apoptosis of cancer cells

Pending Publication Date: 2022-05-27
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The vectors used in the current gene therapy process have problems such as poor safety and low delivery efficiency, and there is an urgent need to develop new gene therapy delivery vectors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation and application of mesenchymal stem cell exosome for delivering RNA (Ribonucleic Acid) medicine at targeted damaged part
  • Preparation and application of mesenchymal stem cell exosome for delivering RNA (Ribonucleic Acid) medicine at targeted damaged part
  • Preparation and application of mesenchymal stem cell exosome for delivering RNA (Ribonucleic Acid) medicine at targeted damaged part

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] This embodiment provides a method for preparing stem cell exosomes targeting tumor sites to deliver gene drugs, which specifically includes the following steps:

[0063] (1) Construction of overexpression plasmid:

[0064] S101, design PCR amplification fragment primers, and introduce the homologous sequence at the end of the linearized cloning vector at the 5' end of the primer, so that the 5' and 3' most end sequences of the amplification product are completely consistent with the sequences at both ends of the linearized cloning vector respectively.

[0065] And send the company to synthesize primers. The primer sequences of PCR amplified fragments are as follows:

[0066] Primer-F (SEQ ID NO. 1):

[0067] CGCGAATTCGAAGTATACCTCGAGGCCACCATGGAGG

[0068] Primer-R (SEQ ID NO. 2):

[0069] CGATCGCAGATCCTTGGATCCTTAGCTGGAGTGAAAACTTGAAGACTCAGA

[0070] S102, the plasmid containing the PGMLV-CMV-MCS-EF1-ZsGreen1-T2A-puro vector ( figure 1 The bacterial solution of the ...

Embodiment 2

[0093] This embodiment provides a method for preparing stem cell exosomes targeting tumor sites to deliver gene drugs, which specifically includes the following steps:

[0094] (1) Construction of overexpression plasmid:

[0095] S101, design PCR amplification fragment primers, and introduce the homologous sequence at the end of the linearized cloning vector at the 5' end of the primer, so that the 5' and 3' most end sequences of the amplification product are completely consistent with the sequences at both ends of the linearized cloning vector respectively. And send the company to synthesize primers. The primer sequences of PCR amplified fragments are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0096] S102, culture the bacterial solution containing the PGMLV-CMV-MCS-EF1-ZsGreen1-T2A-puro vector plasmid overnight, and take 5 ml of fresh bacterial solution to extract the vector plasmid using a plasmid mini-extraction kit.

[0097] S103, mix 1 μg vector plasmid, 3 μL green buffer,...

Embodiment 3

[0119] This embodiment provides a method for preparing stem cell exosomes targeting tumor sites to deliver gene drugs, which specifically includes the following steps:

[0120] (1) Construction of overexpression plasmid:

[0121]S101, design PCR amplification fragment primers, and introduce the homologous sequence at the end of the linearized cloning vector at the 5' end of the primer, so that the 5' and 3' most end sequences of the amplification product are completely consistent with the sequences at both ends of the linearized cloning vector respectively. And send the company to synthesize primers. The primer sequences of PCR amplified fragments are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0122] S102, culture the bacterial solution containing the PGMLV-CMV-MCS-EF1-ZsGreen1-T2A-puro vector plasmid overnight, and take 5 ml of fresh bacterial solution to extract the vector plasmid using a plasmid mini-extraction kit.

[0123] S103, mix 1 μg vector plasmid, 3 μL green buffer, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides preparation and application of a mesenchymal stem cell exosome for delivering an RNA (Ribonucleic Acid) drug at a targeted damaged part, and the exosome with a special property is obtained by transfecting a cell through a lentivirus, so that a delivery system with a stronger targeting property is established and is used for targeted therapy of diseases caused by genes. The preparation of the exosome comprises the following steps: constructing overexpression plasmids, packaging lentiviruses, preparing target protein high-expression mesenchymal stem cells, extracting the exosome and preparing the exosome loaded with siRNA. According to the invention, the exosome with high targeting property is constructed, so that efficient delivery of RNA drugs is realized. Taking tumor cells as an example, expression of surface trend factor protein of the modified exosome is improved by eight times, high targeting and good damaged part aggregation effect are shown, efficient drug release is realized, excellent drug targeting delivery effect is shown in vitro and in vivo, and the modified exosome has excellent biological safety and is a high-safety, high-targeting and high-efficiency drug delivery system. The application range is wide.

Description

technical field [0001] The present invention relates to the technical field of biomedicine, in particular to the preparation and application of mesenchymal stem cell exosomes that target damaged parts to deliver RNA drugs, and the stem cell exosomes can precisely target damaged parts to deliver RNA drug. Background technique [0002] Gene therapy has been used in a variety of diseases, and has gradually become the most compelling frontier in the field of rare disease treatment. The vectors used in the current gene therapy process have problems such as poor safety and low delivery efficiency, and there is an urgent need to develop new gene therapy delivery vectors. Due to the good stability and biological safety of exosomes, the use of exosomes as drug carriers for novel nucleic acid therapy is in full swing, showing great clinical application prospects. Mesenchymal stem cells have natural homing properties and can spontaneously aggregate to the site of injury, inflammation...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/867C12N15/12C12N5/10C12N5/0775C12N15/113C12N15/87A61K9/50A61K47/46A61K31/713A61P35/00
CPCC12N15/86C07K14/7158C12N5/0662C12N15/113C12N15/87A61K9/5068A61K31/713A61P35/00C12N2740/15043C12N2510/00C12N2500/46
Inventor崔大祥徐淑月刘彬
OwnerSHANGHAI JIAO TONG UNIV