CLDN18.2-knockout mouse model with pancreas specificity as well as construction method and application of CLDN18.2-knockout mouse model
A mouse model and specific technology, applied in the construction and application of mouse models, can solve the problems of insidious onset, high degree of malignancy, and less than 10% survival rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 Construction and identification of a mouse model of pancreas-specific knockout of CLDN18.2
[0034]Step 1: According to the sequence of exon No. 1 of C57BL / 6J mouse CLDN18.2 gene, use Cas-Desigher software to detect the first exon of mouse CLDN18.2 gene (Ensembl No.: Cldn18-202 (ENSMUST00000112882.9)) The gRNA target sequences were designed respectively, and the genes in the mouse DBM-DB genome database were searched. The CRISPR off-target effect detection software Cas-OFFinder was used to detect potential off-target sites. The two gRNA sequences were finally selected as follows:
[0035] gRNA1: ATCGATGGGAAGTATTCCTTCGG
[0036] gRNA2:GGGTTGTAGGAAGTACCCGAAGG
[0037] The above-mentioned gRNA1 and gRNA2 were incubated with trancrRNA (purchased from Suzhou Beixin Biotechnology Co., Ltd.) at 25°C for 10 min to form a hairpin structure.
[0038] Step 2: Using the library from the C57BL / 6 mouse, the homology arm and the cKO (exon 1) (conditional Knockout, conditio...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


