Unlock instant, AI-driven research and patent intelligence for your innovation.

CLDN18.2-knockout mouse model with pancreas specificity as well as construction method and application of CLDN18.2-knockout mouse model

A mouse model and specific technology, applied in the construction and application of mouse models, can solve the problems of insidious onset, high degree of malignancy, and less than 10% survival rate

Pending Publication Date: 2022-06-17
TIANJIN TUMOR HOSPITAL
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Pancreatic cancer, as the "king of cancers", has an insidious onset, difficulty in early diagnosis, and is highly metastatic. More than 50% of patients will have distant metastasis at or after diagnosis, losing the chance of radical cure, and the prognosis is extremely poor , the degree of malignancy is extremely high, and its five-year survival rate is less than 10%.
[0005] Existing literature has reported C57BL / 6 mice that knockout Exon1 of CLDN18.2, but in these mouse models, the CLDN18.2 gene is systemically knocked out, and organ and tissue-specific knockout cannot be achieved, and No mouse model of pancreas-specific knockout of CLDN18.2 has been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CLDN18.2-knockout mouse model with pancreas specificity as well as construction method and application of CLDN18.2-knockout mouse model
  • CLDN18.2-knockout mouse model with pancreas specificity as well as construction method and application of CLDN18.2-knockout mouse model
  • CLDN18.2-knockout mouse model with pancreas specificity as well as construction method and application of CLDN18.2-knockout mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Construction and identification of a mouse model of pancreas-specific knockout of CLDN18.2

[0034]Step 1: According to the sequence of exon No. 1 of C57BL / 6J mouse CLDN18.2 gene, use Cas-Desigher software to detect the first exon of mouse CLDN18.2 gene (Ensembl No.: Cldn18-202 (ENSMUST00000112882.9)) The gRNA target sequences were designed respectively, and the genes in the mouse DBM-DB genome database were searched. The CRISPR off-target effect detection software Cas-OFFinder was used to detect potential off-target sites. The two gRNA sequences were finally selected as follows:

[0035] gRNA1: ATCGATGGGAAGTATTCCTTCGG

[0036] gRNA2:GGGTTGTAGGAAGTACCCGAAGG

[0037] The above-mentioned gRNA1 and gRNA2 were incubated with trancrRNA (purchased from Suzhou Beixin Biotechnology Co., Ltd.) at 25°C for 10 min to form a hairpin structure.

[0038] Step 2: Using the library from the C57BL / 6 mouse, the homology arm and the cKO (exon 1) (conditional Knockout, conditio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mouse model with pancreas specific knockout CLDN18.2 as well as a construction method and application of the mouse model. According to the invention, a FloxP mouse capable of performing conditional knockout of CLDN18.2 is established by adopting a CRISPR / Cas9 technology, a No.1 exon is taken as a conditional knockout region, then the mouse is hybridized with a mouse containing a pancreatic specific promoter Pdx1-Cre, and then the hybridized mouse is hybridized with a KP model mouse to obtain the pancreatic CLDN18.2 specific knockout KPC mouse model. The pancreatic specific CLDN18.2 knockout mouse model constructed by the invention can be used as a model tool to be applied to mechanism research of occurrence and development of pancreatic cancer, or can be used as a model tool to be applied to screening of clinical drugs for treating pancreatic cancer and the like.

Description

technical field [0001] The invention relates to the construction of an animal model, in particular to a mouse model of pancreas-specific knockout of CLDN18.2, a construction method and application thereof, and belongs to the field of construction and application of a mouse model of pancreas-specific knockout of CLDN18.2. Background technique [0002] Pancreatic cancer, as the "king of cancers", has an insidious onset, is difficult to diagnose at an early stage, and is highly metastatic. More than 50% of patients will develop distant metastasis at the time of diagnosis or after diagnosis, losing the chance of radical cure and having a very poor prognosis. , the degree of malignancy is extremely high, and its five-year survival rate is less than 10%. Pancreatic cancer has an incidence rate of 3% in men and women, and a mortality rate of 8%, ranking fourth in the mortality rate of malignant tumors, second only to colorectal cancer. Surgery has become an important method for th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N9/22C12N15/85C12N15/89A01K67/027
CPCC12N15/1138C12N9/22C12N15/8509C12N15/89A01K67/0276C12N2310/20A01K2207/15A01K2217/075A01K2227/105A01K2267/0331
Inventor 郝继辉刘静周天兴解永杰常安涛白伟伟李雪洋王轶菲
Owner TIANJIN TUMOR HOSPITAL