Gene PK1 for regulating and controlling cadmium accumulation of rice as well as protein and application of gene PK1

A rice and gene technology, applied in the fields of biotechnology and environment, can solve problems such as the inability to meet the needs of production practice, and achieve the effect of not losing soil fertilizer efficiency

Active Publication Date: 2022-06-24
HUNAN AGRICULTURAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the current theoretical basis is far from meeting the needs of production practice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene PK1 for regulating and controlling cadmium accumulation of rice as well as protein and application of gene PK1
  • Gene PK1 for regulating and controlling cadmium accumulation of rice as well as protein and application of gene PK1
  • Gene PK1 for regulating and controlling cadmium accumulation of rice as well as protein and application of gene PK1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] A gene PK1 that regulates the accumulation of cadmium in rice was found in rice, the gene number is Os12g0632900, and its CDS nucleotide sequence is shown in SEQ ID NO: 1. The protein encoded by this gene PK1 (a rice receptor protein) The amino acid sequence of kinase) is shown in SEQ ID NO:2.

[0033] 1. Construction of PK1 mutant pk1

[0034] To study the role of PK1 in rice, we used gene editing technology to obtain three homozygous mutants 10250-12, 10250-15, 10250-17 ( figure 1 ). The forward primer of the gene editing target sgR-PK1 is GGTGGTGGCGGAGGCGGCAT (its nucleotide sequence is shown in SEQ ID NO: 3), and the reverse primer sequence is ATGCCGCCTCCGCCACCACC (its nucleotide sequence is shown in SEQ ID NO: 4) ), the pair of primers were complementary in vitro to form a double-stranded clone into the intermediate vector, and then cloned into the target vector P1300 (obtained from University of California, San Diego, US) by enzyme digestion to obtain the target...

Embodiment 2

[0055] An application of using the gene PK1 that regulates the accumulation of cadmium in rice or its encoded protein in remediating soil cadmium pollution, namely a method for remediating soil cadmium pollution, comprising the following steps:

[0056] The method of Example 1 was used to cultivate cadmium-contaminated remediation rice (that is, the homozygous mutant of rice pk1 in Example 1), planted in polluted rice fields with a soil cadmium content of 0.5 μg / g dry weight, and used suitable for cadmium pollution in southern hilly areas after maturity. The high amount of rice straw and stubble was removed from the field and harvested with integrated agricultural machinery. After two consecutive years of planting, the soil cadmium content decreased by 30%, and the soil cadmium content in the paddy field became 0.35 μg / g dry weight, indicating that the pk1 mutant The material has a very good repair effect.

Embodiment 3

[0058] An application of utilizing the gene PK1 that regulates the accumulation of cadmium in rice or its encoded protein in rice yield regulation, nitrogen utilization or genetic improvement of root system configuration, comprising the following steps:

[0059] The method of Example 1 was used to cultivate rice pk1 homozygous mutants. After research, it was found that PK1 also had a significant impact on rice growth and development, yield per plant and nitrogen use efficiency at different growth stages of rice. For example, in the 4-week hydroponic seedling period, compared with the wild-type ZH11, the root system configuration of the pk1 mutant was significantly changed, and the plant height and main root length were significantly reduced ( Figure 7 ); the total nitrogen content increased, but the nitrogen physiological utilization efficiency decreased ( Figure 8 ). The yield per plant at maturity was significantly lower than that of wild-type ZH11 ( Figure 9 ). These...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene PK1 for regulating and controlling cadmium accumulation of rice, which is characterized in that the nucleotide sequence of the gene PK1 is as shown in SEQ ID NO: 1; the amino acid sequence of the protein obtained by coding the gene PK1 for regulating and controlling cadmium accumulation of rice is shown as SEQ ID NO: 2. The invention also discloses application of the gene PK1 or the encoding protein thereof in cultivation of cadmium pollution remediation crops, remediation of soil cadmium pollution, rice yield regulation and control, nitrogen utilization or root architecture genetic improvement. According to the rice PK1 gene and the encoding protein thereof, the soil cadmium can be enriched and removed by utilizing the specificity of straw, the content of other nutrient elements in the soil is not obviously influenced, the characteristic that cadmium absorption and transportation are tightly coupled with other necessary elements in the prior art is overcome, and the target of repairing the soil cadmium without losing the fertilizer efficiency of the soil is achieved.

Description

technical field [0001] The invention belongs to the fields of biotechnology and environment, and relates to a rice cadmium accumulation gene PK1, a protein thereof, and applications thereof. Background technique [0002] Cadmium is one of the most biologically toxic heavy metals. After being absorbed by plant roots, cadmium can not only cause strong toxicity to plants and seriously threaten the ecological environment, but also endanger human health after being enriched in the food chain. The geological background value of cadmium in my country is very low, but with the intensification of industrial activities, the overuse of nitrogen fertilizers and soil acidification lead to the increase of cadmium pollution and mobility. Due to the relatively small area of ​​arable land per capita in my country, cadmium-contaminated soil is still used to grow food crops, resulting in frequent cadmium rice incidents, which seriously endangers human health. At present, cadmium pollution mai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/46A01H6/82B09C1/10
CPCC07K14/415C12N15/8243C12N15/8259C12N15/8261B09C1/105B09C2101/00
Inventor张振华罗劲松
OwnerHUNAN AGRICULTURAL UNIV