Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expression vector of human and mammal cell

A technology of expressing vectors and mammals, which is applied in the direction of using vectors to introduce foreign genetic material, genetic material components, gene therapy, etc., and can solve problems such as genetic trait changes and virus dangers

Inactive Publication Date: 2004-08-25
THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Viral promoters, such as cytomegalovirus, adenovirus, SV40, and other promoters, are currently used in mammalian cell gene expression vectors, as well as retrovirus, adenovirus, and other vectors that are commonly used to introduce foreign genes into the human genome. All have the disadvantages of causing unexpected genetic trait changes, producing new viruses that are more dangerous than wild-type viruses, or potential carcinogenic risks

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression vector of human and mammal cell
  • Expression vector of human and mammal cell
  • Expression vector of human and mammal cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Construction of high-efficiency expression vector pBMP6.1 in mammalian cells

[0028] 1. Construction of plasmid T-PolyA containing hsp90β gene PolyA tailed signal sequence

[0029] 1.1 Amplification of the +6497 to +7108bp fragment at the 3′ end of the hsp90β gene:

[0030] According to the sequence of the human hsp90β gene published in the literature (Rebbe, NF et al., J.Biol.Chem. (1989) 264, 15006-15011), a translation stop codon capable of amplifying the PolyA tailed signal sequence containing the hsp90β gene was designed and synthesized A pair of primers P1 and P2 for the 3′ untranslated region and the 12th intron, the primer sequences are as follows:

[0031] P1: 5'CG AGATC +6497 T AGGTTAGGAGTTCATAGTTGG +6518 3' (the underline is the Bgl II site)

[0032] P2: 5'CG +7108 GGATCC CTAGGCTCTGTTCCAT +708 73' (the underline is the BamH I site)

[0033] Using this pair of primers, a DNA fragment of 612 bp consistent with expectations was amplified by...

Embodiment 2

[0045] Example 2 Expression of Human Tumor Suppressor Gene p53 cDNA in New Vector pBMP6.1

[0046] 1. Construction of plasmid pBMP6.1-p53

[0047] First, digest the plasmid pCMV-Neo-BAM containing the p53 cDNA fragment (gifted by Professor B.Volgestein, Johns Hopkins University) with BamHI (Fig. 8), and recover the 1.8Kb p53 cDNA fragment; at the same time, digest the newly created vector pBMP6.1 with SpeI, A 5.3Kb linear DNA was obtained, which was ligated with the p53 cDNA fragment after being blunted by Klenow enzyme and dephosphorylated by CIAP to construct the plasmid pBMP6.1-p53. The construction process of the plasmid is shown in FIG. 9 .

[0048] 2. Detection of the constitutive expression level of plasmid pBMP6.1-p53

[0049] A. method

[0050] 1. Plasmid transfection:

[0051] Basically follow the application of Lipofectamine TM The instructions for transfecting plasmids (Gibco Company) were carried out. Jurkat cells were collected by centrifugation at room tem...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A novel high-efficiency expression vector pBMP6.1 for human and mammalian cells is disclosed, which has the humanized promoter and polyadenyl acid signal. Its application in gene therapy is also disclosed.

Description

technical field [0001] The present invention relates to a novel human and mammalian cell expression vector, hereinafter referred to as pBMP6.1, which has a human-derived promoter and a polyadenylic acid tailed signal fragment. The expression vector of the present invention can efficiently express the heterologous target gene in vitro and can be applied to gene therapy. Background technique [0002] As a promising disease treatment method, gene therapy has made great progress in previous research, and it has gradually been used in clinical practice since the 1990s. However, as an effective clinical treatment, it is far from mature. An important problem is that there is no reliable vector that can be safely used in humans and achieve high-efficiency expression of therapeutic genes in vivo. [0003] Viral promoters, such as cytomegalovirus, adenovirus, SV40, and other promoters, are currently used in mammalian cell gene expression vectors, as well as retrovirus, adenovirus, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85A61K48/00
Inventor 沈珝琲程小款王晓蓉王晓哲刘巨洪
Owner THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com