Synthesis and high-efficiency expression method of bivalent foot-and-mouth disease polypeptide vaccine
A peptide vaccine, foot-and-mouth disease technology, used in genetic engineering, plant genetic improvement, botanical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1. Obtaining and prokaryotic expression of foot-and-mouth disease bivalent polypeptide vaccine gene
[0039] 1. Acquisition of foot-and-mouth disease bivalent polypeptide vaccine gene:
[0040] With the further understanding of the gene structure of foot-and-mouth disease virus and the spatial structure of virus particles, it is found that VP1 protein is the most important antigenic protein of FMDV, and the functional region of VP1 protein contains the main antigenic site of FMDV, especially at site 1, namely The 141-160 amino acid and 200-213 amino acid residue sequences of VP1 protein form the main antigenic region of FMDV, which can induce animals to produce neutralizing antibodies, and is the main epitope fragment that determines the immunogenicity of various subtypes of FMDV. (Yang Yongqin et al., 1997; Dus santos MJ, 2002). Therefore, the use of VP1 protein or its antigenic determinant part has become the main approach for the research of new FMD vacci...
Embodiment 2
[0114] The construction of the prokaryotic expression vector of embodiment 2.FMDV bivalent vaccine gene and GFP gene
[0115] 1. Obtaining and cloning of GFP gene:
[0116] The GFP gene is expressed in the form of a fusion protein, which can be used as a safe and effective reporter gene for the genetic transformation of prokaryotes. The transformation material containing the GFP expression cassette can emit green fluorescence under blue light excitation, which is convenient for detection.
[0117] According to the nucleotide sequence of GFP on GenBank number #U55762, the plasmid
[0118] pEGFP-N1 (CLONTECH Laboratories Inc.#6085-1) was used as the template DNA, and the following pair of primers were designed:
[0119] Primer 5: 5'GCG GAATTC ATGGTGAGCAAGGGCGAGGAG 3'
[0120] EcoR I
[0121] Primer 6: 5'C GTC GAC TTACTTGTACAGCTCGTCCATGCC 3'
[0122] Sal I
[0123] Plasmid pEGFP-N1 was extracted by a small amount of alkali method, and used as a templ...
Embodiment 3
[0130] Example 3. Detection of Immunogenicity of Prokaryotic Expression Products
[0131] Firstly, the fusion gene of the constructed bivalent polypeptide and GFP was induced to express and the protein was purified (the method was performed according to the pET-28a(+) technical specification of Novagen Company), and then the immunogenicity of the expressed product was detected.
[0132] 1. Purified protein
[0133] Centrifuge the BL21 bacterial culture medium containing the prokaryotic expression vectors pET-FM1 and pET-FM2 at 4°C and 6500g for 15 minutes to collect the bacterial cells and remove the supernatant. The pellet was resuspended with 1XIB buffer (20 mmol / L Tris-HCl, pH 7.5, 10 mmol / L EDTA, 1% TritonX-100) of 1 / 10 volume of the original culture solution. Lysozyme plus ultrasonic lysis: add lysozyme to a final concentration of 100 μg / mL, and place at 30°C for 15 minutes. After stirring, place the sample buffer solution in an ice bath, and use an ultrasonic instrumen...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More