Gene recombined medicine of adenovirus carrier and p53 gene for treating proliferative diseases

An adenovirus and recombinant technology, applied in the field of genetic engineering, can solve problems such as low transfection efficiency, low titer of retrovirus reproduction, and reduced immunogenicity

Inactive Publication Date: 2007-07-25
深圳市赛百诺基因技术有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that when the E1 or E3 deletion region of the adenoviral vector carries an exogenous gene, it can achieve a longer expression of the target gene and reduce its immunogenicity; the retroviral vector can carry the exogenous gene integrated into the target gene. Stable and long-lasting expression of the target gene is achieved in the cell genome, but the in vitro reproduction titer and transfection efficiency of the retrovirus are low, and it only infects dividing cells
Random integration of chromosomes, with the risk of carcinogenesis; other viral vectors and non-viral vectors that can be used for gene transfer have different advantages and disadvantages

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene recombined medicine of adenovirus carrier and p53 gene for treating proliferative diseases
  • Gene recombined medicine of adenovirus carrier and p53 gene for treating proliferative diseases
  • Gene recombined medicine of adenovirus carrier and p53 gene for treating proliferative diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0091] As shown in Figure 1 and Figure 2, construct gene recombinants and identify

[0092] 1. The published full cDNA sequence of p53 gene, design and synthesis of two primers:

[0093] 5'ATGGAGGAGCCGCAGTCAGATC and 5'ATATCTGCAGAATTCCAGCAC were used as primers, and linker sequences were introduced at both ends. Using HeLa cell cDNA as a template, the human p53 gene was amplified by PCR. The reaction conditions were as follows: the first cycle: denaturation at 94°C for 4 minutes, annealing at 58°C for 1 minute, and extension at 72°C for 2 minutes; subsequent cycles: 94°C Denaturation at °C for 1 minute, annealing at 58°C for 1 minute, extension at 72°C for 2 minutes, a total of 30 cycles. A large number of p53 genes were thus obtained, analyzed by agarose gel electrophoresis, and the full length of the p53 gene was recovered. After the fragment was purified, the p53 gene was cut with this enzyme, inserted into the pUC19 vector cut with the same enzyme for sequencing, and the c...

Embodiment 2

[0105] Killing effect of gene recombinants on primary cultured fibroblasts in vitro:

[0106] In vitro culture of scar fibroblasts (see Figure 6): the surgically excised scar skin was cut into 0.5-1cm under sterile conditions 3 Put the small pieces into the culture solution containing 1000U / ml penicillin and streptomycin immediately. First wash the tissue twice with PBS (containing penicillin and streptomycin) to remove fat and connective tissue, then wash it several times with D-Hank solution until the liquid has no oil droplets and is not turbid, then cut it to 1mm repeatedly 3 Add a few drops of serum to the tissue pieces, then place the skin pieces on the wall of the culture bottle at appropriate intervals, turn the culture bottle over so that the side with the tissue pieces faces up, add DMEM culture solution containing 10% FBS (note : Do not let the tissue come into contact with the culture medium!), place the side with the tissue block up, put it in a 37°C, 5% CO2 incu...

Embodiment 3

[0113] The therapeutic effect of the gene recombinant on keloid in the clinical research of gene therapy for scar.

[0114] As shown in Figure 10A and Figure 10B, a female patient with keloid had surgery on the left chest due to post-acne scar. Volume 2×1×1cm 3(See Figure 10A). After 4 weeks of gene therapy, the anterior chest scar shrunk significantly, its volume shrank significantly, and local tissues became dark (see Figure 10B). Except for self-limited fever, no other obvious toxic side effects were observed. The results of clinical trials show that gene recombinants are safe and effective in treating keloids.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A kind of recombinant gene medicine of adenovirus vector and gene p53 which can treat proliferative diseases is a confusion sequence constructed from adenovirus vector and human tumor inhibition gene p53 expression kit. In the present invention, we made homologous recombination of adenovirus vector with human gene p53 in procaryotic cells (E. coli), then obtained the recombinant gene medicine of adenovirus vector and human gene p53 expression kit. The human p53 gene expression kit is a characteristic sequence consisting of promoter-p53 cDNA-polyadenine nucleotide. The medicine can be used to prepare clinic gene therapeutic products for treating proliferative disease such as cheloid.

Description

technical field [0001] The present invention relates to genetic engineering technology, and more specifically relates to the application of a gene recombinant constructed from human tumor suppressor gene p53 and adenovirus vector recombination sequence in the preparation of drugs for treating proliferative diseases. Background technique [0002] Proliferative disease is a genetic disease characterized by cell proliferation and / or abnormal expression of metabolites. It is a benign hyperplasia that occurs widely in various tissues and organs of the human body (such as skin, bone marrow, breast, etc.) and produces varying degrees of dysfunction. . Scar is the inevitable product and final result in the process of human wound repair, and the healing of any wound will be formed by different degrees of scar. Scars are divided into normal scars and pathological scars. Pathological scars include hypertrophic scars and keloids, both of which are characterized by tumor-like hyperplas...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K48/00C12N15/861A61P43/00A61P17/00A61P15/14A61P19/08A61K35/76A61K38/00C12N15/12
CPCC12N2710/10332A61K35/761C12N7/00A61K38/1758C12N2710/10343A61K48/00C12N15/86A61P15/14A61P17/00A61P17/02A61P19/08A61P35/00A61P43/00Y02A50/30A61K2300/00C12N15/861A61K38/00A61K35/76
Inventor彭朝晖张晓志
Owner深圳市赛百诺基因技术有限公司