Human fusion antibody for reducing cerebral amyloid fibers associated with senile dementia

A human antibody, amyloid peptide technology, applied in the direction of antibodies, drug combinations, introduction of foreign genetic material using vectors, etc., can solve problems such as the difficulty of anti-Aβ antibodies

Inactive Publication Date: 2003-02-12
张小如 +1
View PDF0 Cites 30 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, it is relatively difficult to prepare human anti-Aβ antibodies.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human fusion antibody for reducing cerebral amyloid fibers associated with senile dementia
  • Human fusion antibody for reducing cerebral amyloid fibers associated with senile dementia
  • Human fusion antibody for reducing cerebral amyloid fibers associated with senile dementia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Eukaryotic cell expression of fusion antibody

[0031] Construction of fusion human antibody DNA containing tPA signal polypeptide

[0032] Human antibody Fc genes were selectively amplified from a lymphocyte library using a PCR method. Choose EXPEND HIGH FIDELITY PCR KIT from ROCHE Company. The PCR reaction includes 38ul deionized water, 5ul 10X buffer provided by the kit, 3ul DMSO, 1ul dNTP (10mM dATP, 10mMdCTP, 10mM dGTP, 10mM dTTP), 1ul mixed DNA polymerase provided by the kit, 1ul10uM containing BamH1 endonuclease Enzyme site forward primer AGTTGGATCCGACAAAACTCACACATG and 1ul 10uM reverse primer TCTAGACTCGAGTTATTTACCCGGAGACAG containing XhoI endonuclease site, 1ul human lymphocyte cDNA library (CloneTech). The PCR reaction uses 94°C, 30 seconds; 54°C, 30 seconds; 72°C, 1 minute; a total of 30 cycles. After separation by 1% agar electrophoresis to confirm that the PCR product contains Fc-sized DNA, extract 1 ul and add 1 ul of 1uM concentration of the ...

Embodiment 2

[0039] Example 2 Expression of Fusion Antibody in Bacterial Expression System

[0040] There are two types of fusion human antibodies expressed in bacteria. One is to add a methionine only before the fusion antibody, and the fusion antibody is mainly concentrated in the inclusion body in the bacteria after expression; the other has a signal polypeptide secreted into the bacterial cell interstitium at the amino terminal of the fusion antibody. The basic requirement for a bacterial expression vector is a bacterial expression promoter at the 5' end of the target gene. The expression vector used in the present invention is pET22b+ (Novagen), which has a T7 promoter. The signal polypeptide sequence used in the present invention is the pelB signal polypeptide:

[0041] MKYLLPTAAAGLLLLAAQPAMA

[0042] The amino acid sequence of the fusion antibody containing the bacterial interstitial signal polypeptide is:

[0043] MKYLLPTAAAGLLLLAAQPAMAKL VFFAEDVGSNKGA VGSDKTHTCPPCPAPELLGGPSV...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A human fusion antibody for preventing and treating senile dementia features that the beta-amyloid peptide and the recognition and bind regions of the fibres generated by it, the connecting peptide of 2-4 amino acids, and the human antibody Fc segment recognized by human immunocells are sequentially contained by its terminals from N to C. The fusion gene for coding the said antibody is also disclosed.

Description

technical field [0001] The present invention generally relates to immune preparations for treating senile dementia, and more specifically, the present invention provides a fusion human antibody capable of treating and preventing senile dementia. Background technique [0002] The incidence of senile dementia (also known as Alzheimer's Disease (AD)) is on the rise with the aging of the social population. Among the more than 200 million total population of the United States, there are 4.8 million AD patients in different degrees, accounting for about 2% of the total population, and the incidence rate is higher among the elderly over 60 years old. The disease has shown the trend of epidemic development in recent years, and the incidence rate will be higher in the future. There is also a similar incidence rate in our country. The main pathological feature of AD disease is that neuropathic plaques are produced in the areas related to memory and cognition in the patient's brain. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/395A61P25/28C07K16/44C12N15/62C12N15/79
Inventor张小如张冀民
Owner张小如