Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Human amino acid transporter, its coding sequence, preparing method and use

A nucleotide sequence and sequence technology, applied in the application of polynucleotides and polypeptides, the field of new human gene nucleotide sequences, can solve the problems of hNAT-1 unreported and so on

Inactive Publication Date: 2003-03-12
FUDAN UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] However, so far, hNAT-1 of the present invention has not yet been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Cloning and Determination of the cDNA Sequence of hNAT-1

[0046] 1. Primer amplification

[0047] Human testis λgt10 cDNA library (purchased from Clontech) was used as template, and two pairs of oligonucleotides were used as primers: A1 GTACGGAATG CCGGAAGGGC CGG; B1 C TTCCAGATTTCAAATGTTAC AG as forward primer; A2: CACAGTATAT GGGCAATATT GAG; B2TTCTTG TAAGAAGTAG GAAAATA as reverse primer Primers for PCR. The PCR conditions were 93°C for 4 minutes, followed by 35 cycles of 93°C for 1 minute, 64°C for 1 minute and 72°C for 1 minute, and finally 72°C for 5 minutes. The PCR fragments detected by electrophoresis are fragments and impurities of about 900 and 700 base pairs in size respectively. Impurities were removed, the above two fragments were respectively digested with NcoI, and then ligated to obtain the target fragment.

[0048] 2. Sequencing of PCR products

[0049] Combine the above target fragment with pGEM-T TM The vector (Promega) was ligated, transformed into...

Embodiment 2

[0052] Expression of hNAT-1 in Escherichia coli

[0053] In this example, the cDNA sequence encoding hNAT-1 was amplified with PCR oligonucleotide primers corresponding to the 5' and 3' ends of the DNA sequence to obtain hNAT-1 cDNA as an insert.

[0054] The 5' oligonucleotide primer sequence used in the PCR reaction is:

[0055] 5'GGAG GGATCCATGG AGGCGTCCTG GGGGA, the primer contains the restriction endonuclease restriction site of BamHI, after the restriction site is the partial coding sequence of hNAT-1 beginning with the initiation codon;

[0056] The 3' end primer sequence is:

[0057] 5'ATTT CTGCAGTTTA TTAATCCAAT CAAAA, the primer contains the restriction endonuclease site of PstI, translation terminator and partial coding sequence of hNAT-1.

[0058]The restriction endonuclease cutting sites on the primers correspond to the restriction endonuclease cutting sites on the bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, CA), which encodes antibiotic resistanc...

Embodiment 3

[0063] Expression of hNAT-1 in eukaryotic cells (CHO cell lines)

[0064] In this example, the cDNA sequence encoding hNAT-1 was amplified with the following oligonucleotide primers to obtain hNAT-1 cDNA as an insert.

[0065] The 5' oligonucleotide primer sequence used in the PCR reaction is:

[0066] 5’-GGAG GGATCCATGG AGGCGTCCTG GGGGA

[0067] The primer contains a BamHI restriction endonuclease restriction endonuclease site, followed by a part of the coding sequence of hNAT-1 starting from the start codon after the restriction site;

[0068] The 3' end primer sequence is:

[0069] 5’-ATTT CTGCAGTTTA TTAATCCAAT CAAAA

[0070] The primer contains an enzyme cutting site of PstI restriction endonuclease, a translation terminator and a partial coding sequence of hNAT-1.

[0071] The restriction endonuclease cutting site on the primer corresponds to the restriction endonuclease cutting site on the CHO cell expression vector pcDNA3, and this plasmid vector encodes antibiotic ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A human N system amino acids transporter (hNAT-1), its coding sequence, its preparing process and its use are disclosed. The nucleic acid and antisence strand or fragment of said hNAT-1 can be used to prepare the probe for detecting the abnormality of hNAT-1 gene. The hNAT-1 protein or its suppressor can be used to prepare medicines or reagent kit for regulating the bioactivity of living body, especially the liver cells.

Description

technical field [0001] The present invention relates to the field of genetic engineering, in particular, the present invention relates to a novel human gene nucleotide sequence. More specifically, the present invention relates to a cDNA sequence of human N system amino acid transporter (hNAT-1), the present invention also relates to the polypeptide encoded by the nucleotide sequence, the application of these polynucleotides and polypeptides, and the A method for producing the polynucleotide and the polypeptide. Background technique [0002] Amino acids are the basic units of protein molecules, and proteins are the basis of life activities. Most of the proteins in the body are continuously decomposed and synthesized, and the cells constantly use amino acids to synthesize proteins and decompose proteins into amino acids. Amino acids and proteins are converted to each other and transported to designated sites to perform functions and guide the physiological activities of orga...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07H21/00C07K14/435C07K16/18C12N15/11C12N15/12C12N15/63C12N15/70C12N15/79G01N33/563
Inventor 余龙唐丽莎郭金虎
Owner FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com