Human amino acid transporter, its coding sequence, preparing method and use
A nucleotide sequence and sequence technology, applied in the application of polynucleotides and polypeptides, the field of new human gene nucleotide sequences, can solve the problems of hNAT-1 unreported and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0045] Cloning and Determination of the cDNA Sequence of hNAT-1
[0046] 1. Primer amplification
[0047] Human testis λgt10 cDNA library (purchased from Clontech) was used as template, and two pairs of oligonucleotides were used as primers: A1 GTACGGAATG CCGGAAGGGC CGG; B1 C TTCCAGATTTCAAATGTTAC AG as forward primer; A2: CACAGTATAT GGGCAATATT GAG; B2TTCTTG TAAGAAGTAG GAAAATA as reverse primer Primers for PCR. The PCR conditions were 93°C for 4 minutes, followed by 35 cycles of 93°C for 1 minute, 64°C for 1 minute and 72°C for 1 minute, and finally 72°C for 5 minutes. The PCR fragments detected by electrophoresis are fragments and impurities of about 900 and 700 base pairs in size respectively. Impurities were removed, the above two fragments were respectively digested with NcoI, and then ligated to obtain the target fragment.
[0048] 2. Sequencing of PCR products
[0049] Combine the above target fragment with pGEM-T TM The vector (Promega) was ligated, transformed into...
Embodiment 2
[0052] Expression of hNAT-1 in Escherichia coli
[0053] In this example, the cDNA sequence encoding hNAT-1 was amplified with PCR oligonucleotide primers corresponding to the 5' and 3' ends of the DNA sequence to obtain hNAT-1 cDNA as an insert.
[0054] The 5' oligonucleotide primer sequence used in the PCR reaction is:
[0055] 5'GGAG GGATCCATGG AGGCGTCCTG GGGGA, the primer contains the restriction endonuclease restriction site of BamHI, after the restriction site is the partial coding sequence of hNAT-1 beginning with the initiation codon;
[0056] The 3' end primer sequence is:
[0057] 5'ATTT CTGCAGTTTA TTAATCCAAT CAAAA, the primer contains the restriction endonuclease site of PstI, translation terminator and partial coding sequence of hNAT-1.
[0058]The restriction endonuclease cutting sites on the primers correspond to the restriction endonuclease cutting sites on the bacterial expression vector pQE-9 (Qiagen Inc., Chatsworth, CA), which encodes antibiotic resistanc...
Embodiment 3
[0063] Expression of hNAT-1 in eukaryotic cells (CHO cell lines)
[0064] In this example, the cDNA sequence encoding hNAT-1 was amplified with the following oligonucleotide primers to obtain hNAT-1 cDNA as an insert.
[0065] The 5' oligonucleotide primer sequence used in the PCR reaction is:
[0066] 5’-GGAG GGATCCATGG AGGCGTCCTG GGGGA
[0067] The primer contains a BamHI restriction endonuclease restriction endonuclease site, followed by a part of the coding sequence of hNAT-1 starting from the start codon after the restriction site;
[0068] The 3' end primer sequence is:
[0069] 5’-ATTT CTGCAGTTTA TTAATCCAAT CAAAA
[0070] The primer contains an enzyme cutting site of PstI restriction endonuclease, a translation terminator and a partial coding sequence of hNAT-1.
[0071] The restriction endonuclease cutting site on the primer corresponds to the restriction endonuclease cutting site on the CHO cell expression vector pcDNA3, and this plasmid vector encodes antibiotic ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com