Vaccine for specificity treating tumour or endocellular infection and application
An antigenic, recombinant viral vector technology, used in anti-tumor drugs, specific peptides, and the introduction of foreign genetic material using vectors.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] Construction of adenovirus selectively proliferating tumor cells overexpressing ErbB2 receptor gene
[0067] Due to the overexpression of the ErbB2 receptor gene in tumors, the ErbB2 promoter can effectively initiate transcription in tumor cells. In this example, the early promoter of the E1 region of the adenovirus was replaced with the ErbB2 promoter, thereby constructing an adenovirus capable of selectively proliferating in tumor cells (see figure 1 , below left). Methods as below:
[0068] Plasmids PXCI and PBHG10 were purchased from Microbix Biosystems (Toronto, Canada), wherein plasmid PXCI contained the adenovirus Ad5 bp22-5790 fragment. PBHG10 contains in addition to adenovirus E 1 Region (bp188-1339) and E 3 The entire genome of adenovirus outside the region (bp28133-30818).
[0069] Using the PCR method, a T was added between the 551 and 552 positions of the gene of the plasmid PXCI to create an AgeI site, and the plasmid number was PXCI-T.
[0070] Synt...
Embodiment 2
[0076] Construction of tumor cell lysing function and specific induction against ErbB 2 Recombinant adenovirus for T-cell immune response of receptor-overexpressing tumor cells
[0077] In this embodiment, all genes in the E3 region of the adenovirus genome are deleted, and only the ADP coding region is retained, so as to construct an adenovirus capable of lysing tumor cells. Then insert the expression cassette of the heat shock protein-antigenic peptide into the adenovirus to construct an adenovirus that specifically induces a T cell immune response against ErbB2 receptor overexpressing tumor cells (see figure 1 , below the middle).
[0078] 2.1 Construction of a plasmid that only retains the ADP coding region in the E3 region
[0079] Plasmid pBHG 11 Purchased from Microbix Biosystems (Toronto, Canada).
[0080] Complete digestion with XbaI and partial digestion of plasmid pBHG with BamHI 11 , isolate the 14kb fragment, then fill in with Klenow enzyme, and connect with ...
Embodiment 3
[0105] Construction of a recombinant adenovirus capable of lysing tumors and inducing Th-cell immune responses against ErbB3 receptor overexpressing tumor cells
[0106] In this example, a method similar to Example 2 was used to construct a recombinant adenovirus containing an expression cassette for another fusion protein (ie, a fusion protein of Mycobacterium bovis Hsp65 and a partial antigen of human ErbB3). The adenovirus can lyse tumor cells and induce 3 Receptor overexpression tumor cell Th-cell immune response. Methods as below:
[0107] 3.1 Construction of the plasmid containing the fusion gene of Mycobacterium bovis Hsp65 and human ErbB3 partial antigen
[0108] Synthesize the following primers:
[0109] 5'ccttaagatggactgcgtggcagagggcaaagt (SEQ ID NO: 16)
[0110] 5'ggggagcctcgagaatttgcccatatggccaagacaattgcgt (SEQ ID NO: 17)
[0111] 5'aagcggccgctcagaaatcatccatgccaccca (SEQ ID NO: 18)
[0112] Using the Mycobacterium bovis genomic DNA extracted by conventional m...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 