Unlock instant, AI-driven research and patent intelligence for your innovation.

Vaccine for specificity treating tumour or endocellular infection and application

An antigenic, recombinant viral vector technology, used in anti-tumor drugs, specific peptides, and the introduction of foreign genetic material using vectors.

Inactive Publication Date: 2004-08-04
张聪慧
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Antigenics obtained the patent of heat shock protein non-covalent binding peptide complex GP96 and used it to treat kidney cancer patients, and the phase III trial effect is good, but its inconvenience is that it is a personalized vaccine
[0011] So far, there are no targeted drugs that effectively treat tumors or intracellular infections

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vaccine for specificity treating tumour or endocellular infection and application
  • Vaccine for specificity treating tumour or endocellular infection and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Construction of adenovirus selectively proliferating tumor cells overexpressing ErbB2 receptor gene

[0067] Due to the overexpression of the ErbB2 receptor gene in tumors, the ErbB2 promoter can effectively initiate transcription in tumor cells. In this example, the early promoter of the E1 region of the adenovirus was replaced with the ErbB2 promoter, thereby constructing an adenovirus capable of selectively proliferating in tumor cells (see figure 1 , below left). Methods as below:

[0068] Plasmids PXCI and PBHG10 were purchased from Microbix Biosystems (Toronto, Canada), wherein plasmid PXCI contained the adenovirus Ad5 bp22-5790 fragment. PBHG10 contains in addition to adenovirus E 1 Region (bp188-1339) and E 3 The entire genome of adenovirus outside the region (bp28133-30818).

[0069] Using the PCR method, a T was added between the 551 and 552 positions of the gene of the plasmid PXCI to create an AgeI site, and the plasmid number was PXCI-T.

[0070] Synt...

Embodiment 2

[0076] Construction of tumor cell lysing function and specific induction against ErbB 2 Recombinant adenovirus for T-cell immune response of receptor-overexpressing tumor cells

[0077] In this embodiment, all genes in the E3 region of the adenovirus genome are deleted, and only the ADP coding region is retained, so as to construct an adenovirus capable of lysing tumor cells. Then insert the expression cassette of the heat shock protein-antigenic peptide into the adenovirus to construct an adenovirus that specifically induces a T cell immune response against ErbB2 receptor overexpressing tumor cells (see figure 1 , below the middle).

[0078] 2.1 Construction of a plasmid that only retains the ADP coding region in the E3 region

[0079] Plasmid pBHG 11 Purchased from Microbix Biosystems (Toronto, Canada).

[0080] Complete digestion with XbaI and partial digestion of plasmid pBHG with BamHI 11 , isolate the 14kb fragment, then fill in with Klenow enzyme, and connect with ...

Embodiment 3

[0105] Construction of a recombinant adenovirus capable of lysing tumors and inducing Th-cell immune responses against ErbB3 receptor overexpressing tumor cells

[0106] In this example, a method similar to Example 2 was used to construct a recombinant adenovirus containing an expression cassette for another fusion protein (ie, a fusion protein of Mycobacterium bovis Hsp65 and a partial antigen of human ErbB3). The adenovirus can lyse tumor cells and induce 3 Receptor overexpression tumor cell Th-cell immune response. Methods as below:

[0107] 3.1 Construction of the plasmid containing the fusion gene of Mycobacterium bovis Hsp65 and human ErbB3 partial antigen

[0108] Synthesize the following primers:

[0109] 5'ccttaagatggactgcgtggcagagggcaaagt (SEQ ID NO: 16)

[0110] 5'ggggagcctcgagaatttgcccatatggccaagacaattgcgt (SEQ ID NO: 17)

[0111] 5'aagcggccgctcagaaatcatccatgccaccca (SEQ ID NO: 18)

[0112] Using the Mycobacterium bovis genomic DNA extracted by conventional m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

A recombinant virus carrier is disclosed. An expression box of heat shock-protein-antigenic peptide's fusion protein is inserted in the genome of said virus. Said expression box contains sequentially promoter sequence, the code sequence of heat shock protein-antigenic peptide's fusion protein, and termination codon. Said virus can selectively infect and crack the tumor cells or intracellar microbial infectious cells and excessively express the fusion protein of specific antigen, so effectively stimulating the immunoresponse reaction.

Description

technical field [0001] The present invention relates to the field of biotechnology, more specifically to a recombinant viral vector, the expression vector selectively infects tumors or intracellularly infected cells or tissues but not normal tissues or cells, and effectively kills tumors or infected cells Highly express specific antigen fusion proteins, thereby inducing the body to produce specific immune responses against tumors or infected cells. The present invention also relates to the construction method and therapeutic application of the expression vector. Background technique [0002] The treatment of malignant tumors still mainly relies on surgery, radiotherapy and chemotherapy, none of which can effectively solve the metabolic metastasis and recurrence of tumors. In addition, for the treatment of intracellular infections such as hepatitis B, there are currently no drugs with satisfactory curative effects except interferon. [0003] However, there is a considerable...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/12A61P35/00C07K19/00C12N15/62C12N15/86
Inventor 张聪慧
Owner 张聪慧