Vaccine preparing process and antitumor vaccine

A technology of vaccines and tumor cells, applied in the biological field, can solve problems such as pollution

Active Publication Date: 2004-11-24
SHEN ZHEN TSINGHUA YUANXING BIO PHARM SCI & TECHNOL
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, both types of vaccines are potentially dangerous because they can be contaminated with infectious germs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vaccine preparing process and antitumor vaccine
  • Vaccine preparing process and antitumor vaccine
  • Vaccine preparing process and antitumor vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0155] Example 1 EGFR recombinant DNA vaccine

[0156] Design PCR primers (human primers are: 5) according to the cDNA sequences of human, mouse, chicken, and EGFR molecules collected in various public databases such as GenBank (corresponding to SEQ ID NO 1-5, 7-9, 19) 'GACCATGGAGGAAAAGAAAGTTTGC 3', 5'ACGAATTCTTAGGACGGGATCTTAGGCCCA3'; the primers for mice are: 5'GACCATGGAGGAAAAGAAAGTCTGC 3', 5'ACGAATTCTTAATAGATGGTATCTTTGGC 3'; the primers for chicken are: 5'GACCATGGAGAGTTAGAGGATTAG, GTTTAGGAGTTAG, GTTTAG, human lung cancer, respectively The total RNA of cell line A431, mouse lung cancer cell line LL2 and chicken embryo were used as templates for RT-PCR amplification, and the amplified EGFR fragments (all 1.9 kb) were collected and purified by electrophoresis, and then the PCR products were subcloned. After confirming the PCR subclones and sequencing, they were digested with NcoI and EcoRI, and the 1.9 kb fragment was collected and purified, and inserted into the pORF-MCS (InvivoGe...

Embodiment 2

[0161] Example 2 EGFR recombinant protein vaccine (E. coli expression)

[0162] As mentioned above, the PCR primers (human, mouse, chicken, and EGFR molecule cDNA sequences (corresponding to SEQ ID NO 1-5, 7-9, 19) collected in GenBank and other public databases, respectively) are used to design PCR primers (human The primers are: 5'GACCATGGAGGAAAAGAAAGTTTGC 3', 5'ACAGATCTAGGACGGGATCTTAGGCCCA 3'; the primers for mice are: 5'GACCATGGAGGAAAAGAAAGTCTGC 3', 5'ACAGATCTATAGATGGTATCTTTGGC 3'; the primers for chicken are: GTCAGACCTAGTAGGTTAGTTACAGAGTAGTGTTAG '), using pORF-hEGFR, pORF-mEGFR and pORF-chEGFR as templates for PCR amplification, electrophoresis to collect and purify the amplified EGFR fragments (all 1.9 kb), and then perform PCR product subcloning. After the PCR subclones were confirmed by sequencing, they were digested with NcoI and BglII, and the 1.9 kb fragment was collected and purified, and inserted into the pQE60 (QIAGEN company) vector digested with NcoI and BglII, and...

Embodiment 3

[0166] Example 3 EGFR recombinant protein vaccine (Yeast Pichia pastoris expression)

[0167]As mentioned above, the PCR primers (human, mouse, chicken, and EGFR molecule cDNA sequences (corresponding to SEQ ID NO 1-5, 7-9, 19) collected in GenBank and other public databases, respectively) are used to design PCR primers (human The primers are: 5'ATACTCGAGAAAAGAGAGCTGGAGGAAAAGAAAG 3', 5'GCTCTAGAATGGCACAGGTGGCACA 3'; the primers for mouse are: 5'ATGCTCGAGAAAA GAGAGTTGGAGGAAAAGAAAGTC 3', 5'AAGCGGCCGCCATAGATGGTATCTTTG 3'; the primers for chicken are: AAAAGAGTTTAGGATTAGTAGAAGTTAGTAGGTAGGTAGGAGTTAG 3'5AGAGAGTTTAGGATTAGTAGATGAGTTAGTAGAGTTAGTAGAGTTAGTAGAGTTAGTAAGTAG '), using pORF-hEGFR, pORF-mEGFR and pORF-chEGFR as templates for PCR amplification, electrophoresis to collect and purify the amplified EGFR fragments (all 1.9 kb), and then perform PCR product subcloning. After the PCR subclones were confirmed by sequencing, they were digested with XhoI and XbaI (for mouse clones as XhoI and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
particle diameteraaaaaaaaaa
Login to View More

Abstract

The vaccine preparing process includes the steps of: analyzing the specific antigen of specific pathogen; obtaining the polynucleotide sequence encoding the specific antigen; obtaining polynucleotide sequence with sufficient difference from the polynucleotide sequence; and utilizing the polynucleotide sequence obtained in the last step to prepare vaccine. The present invention also provides EGFR molecular vaccine as an antitumor vaccine, and the EGFR molecular vaccine may be conventional preparation, such as aqua preparation, or nano preparation. EGFR molecular vaccine has antitumor effect capable of being strengthened under the synergistic effect of other immunity promoting factor.

Description

Technical field [0001] The present invention relates to the field of biotechnology, in particular to a vaccine preparation method and prepared biological vaccines, especially novel anti-tumor vaccines, such as EGFR molecular vaccines. Molecular vaccines belong to the category of New Biotechnological drugs, involving a variety of biotechnologies, such as PCR technology, molecular cloning technology, gene expression technology, modern vaccine technology, and biotechnological pharmacology and pharmacy. Background technique [0002] A vaccine is a substance that can stimulate the body's immune system to produce an immune response against specific target substances (such as viruses, bacteria, etc.). The classic vaccine concept comes from anti-infective immunity, which mainly uses treated pathogenic microorganisms (such as viruses, bacteria, etc.) and their derivatives to immunize the body to produce a humoral immune response to prevent infectious diseases. For example, inactivated vac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K39/00
CPCA61K2039/5256A61K39/0011A61K2039/53A61P35/00A61K39/001104
Inventor魏于全田聆
OwnerSHEN ZHEN TSINGHUA YUANXING BIO PHARM SCI & TECHNOL