Construction, expression and purification method of recombinant human parathyroid hormone in colibacillus
A technology of parathyroid hormone and Escherichia coli, which is applied in the field of medical bioengineering, can solve the problems of high price and high production process cost, and achieve the effect of avoiding renaturation steps and simplifying the purification process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0035] 1. Construction of recombinant expression plasmid rhPTH(1-34) / pET-35b(+) Gene construction process ( figure 1 ).
[0036] The rhPTH(1-34) template sequence is: CCGCGG GT TCCGTTTCTGAAATCCAGCTGATGCACAACCTGGGTAAACACCTGAACTCTATGGAACGTGTTGAATGGCTGCGTAAGAAACTGCAGGACGTACACAACTTCTAA CTCGAG (The dashed lines are respectively the restriction sites of SacII and XhoI, and the dashed lines encode the Factor Xa recognition site Ile-Glu-Gly-Arg↓.) The upstream primer sequence is: GGACTG CCGCGG GTATTGAGGGTCGCTCCGTTTC (The underline is the restriction site of SacII.)
[0037] The downstream primer sequence is: GCACAT CTCGAG TTAGAAGTTGTGTACGTCC (the underline is the restriction site of XhoI). The rhPTH(1-34) gene was obtained by PCR amplification, and 0.1 μL of the artificially synthesized rhPTH(1-34) gene template was taken respectively, and the upstream primer and downstream primer were each added to a final concentration of 1 μmol / L, and then 25 mmol / L MgCl was added 2 5 μL...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com