Method of preparing virus sample parlicle of human papillomavirus
A human papillomavirus and virus-like technology, applied in the field of virus-like particles, can solve the problems of cumbersome purification process and poor uniformity of virus-like particles, and achieve the effect of simple purification process, low cost and good uniformity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1 Obtaining of HPV 6L1, HPV 16L1HPV 58L1, Coding Sequence
[0047] 1. Using the cervical cancer pathological tissue genome as a template, use the following primers to amplify the sequences of HPV6, 16, and 58L1 according to the conventional PCR method.
[0048] HPV6 upstream primer: 5′CTCGAGAAAAGAATGTGGCGGCCTAGCG3
[0049] HPV6 downstream primer: 5'TTACCTTTTAGTTTTGGC3'
[0050] HPV16 upstream primer: 5'CTCgAgAAAAgAATgTCCTTTTTggCTgCCT 3'
[0051] HPV16 downstream primer: 5'TTACagCTTACgTTTTTTgC 3'.
[0052] HPV58 upstream primer: 5′CTC gAgAAAAgAATggTgCTgATTTTATgT 3′
[0053] HPV58 downstream primer: 5′TTATTTTTTAACCTTTTTg3′
[0054] The primers were used to introduce the XhoI restriction site and the sequence AAAAgA to improve secretion.
[0055] 2. Using the polymerase chain reaction (PCR) synthesis method, according to the codon preference of Pichia pastoris, synthesize HPV6L1, HPV16L1 and HPV58L1 genes, and introduce the XhoI restriction site and the sequen...
Embodiment 2
[0056] The acquisition of embodiment 2 recombinant Pichia pastoris
[0057] 1. Construction of recombinant yeast integration plasmids (pPICZαB-6L1 and pPICZαB-m6L1)
[0058] The PCR products obtained in Example 1 were connected with T-easy respectively, and transformed into TOP10, the T-HPV6L1 and T-HPVm6L1 plasmids were extracted by alkaline lysis, the plasmids were double-digested with XhoI and Not I, and the reagents were recovered by agarose electrophoresis The HPV-6L1 and m6L1 gene fragments were recovered from the box, connected with the pPICZαB vector (Invitrogen Company) that was cut with the same restriction enzyme, and transformed into TOP10 strain, screened with LB plates containing zeocin resistance, and positive clones were obtained, and a small amount of plasmid was extracted, and subjected to enzyme digestion electrophoresis After identification, the obtained recombinant yeast cell integration plasmids were named pPICZαB-6L1 and pPICZαB-m6L1. Enzyme digestion e...
Embodiment 3
[0068] The secretory expression of embodiment 3HPV6, 16 and 58L1 protein in recombinant yeast
[0069] 1. The induced expression is divided into two stages. The first is the growth stage. In this stage, glycerol is used as the carbon source to accumulate bacterial cells, and there is no expression of the target protein. The second is the induced expression stage. In this stage, methanol is used as the only carbon source, and the bacteria grow slowly, and the target protein is secreted and expressed under the induction of methanol. Culture process: Pick fresh single colonies from the YPD plate and insert them into shake flasks containing 30mL BMGY, cultivate them on a shaking table for 24h as seed liquid, draw 1.3mL into 250mL shake flasks containing 40mL BMGY to enter the growth stage, cultivate them on a shaker table for 24h, and centrifuge at room temperature ( 6000r / min 6min), the bacteria were suspended with 15mL BMMY, put back into the shaker culture and entered the induc...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More