Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mosaic vaccine of Ag85B and ESAT-6

A vaccine, subunit vaccine technology, applied in the field of genetic engineering

Inactive Publication Date: 2007-03-07
FUDAN UNIV
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, after searching, there is no report on the vaccine similar to the present invention at present

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mosaic vaccine of Ag85B and ESAT-6
  • Mosaic vaccine of Ag85B and ESAT-6
  • Mosaic vaccine of Ag85B and ESAT-6

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1 Ag85B, the preparation of the chimeric subunit vaccine of ESAT-6

[0035] 1.1 Preparation of genomic DNA of Mycobacterium tuberculosis H37Rv strain

[0036] Mycobacterium tuberculosis (H37Rv) was cultured in 7H9Broth medium for 4 weeks at 80°C for 2 hours to inactivate. Genomic DNA was extracted with a bacterial DNA (miniature) extraction kit. Due to the thick wall of TB bacteria, the digestion time of the bacteria is extended to 3 to 5 hours.

[0037] 1.2 Amplification of Mycobacterium tuberculosis H37Rv strain ag85b, esat-6 gene

[0038] Primers were designed according to the ag85b, esat-6 gene and the multiple cloning site of the vector. Primers were designed as follows:

[0039] ag85b:

[0040] Upstream: 5'TAAGAATTCTTCTCCCGGCCGG-G 3'EcoRI

[0041] Downstream: 5'TAAGCGGCCGCTCAGCCGGCGCCT 3'NotI

[0042] esat6:

[0043] Upstream: 5'TAATCGCGATGACAGAG-CAGCAGTG 3'NruI

[0044] Downstream: 5'TAACTCGAGGCGAACATCCCAGTGA3'XhoI

[0045] PCR reaction system:...

Embodiment 2

[0052] Example 2 Vaccine immunization of mice and determination of immune indexes

[0053] Using Ag85B, the chimeric subunit vaccine of ESAT-6 (referred to as A N -E-A C ) and the adjuvant MPL-TDM to co-immunize C57BL / c mice, and at the same time, the fusion subunit vaccine of Ag85B-ESAT-6 (abbreviated as A-E) and Tris-MPL (ie monophospholactone A)-TDM (ie trehalose disopyramide mycolate) as a control. Vaccines were given once every two weeks for a total of three immunizations. After immunization, blood was collected to detect the expression level of serum antibody by ELISA method. Spleen was isolated aseptically, and the expression of IFN-γ after spleen cells were stimulated by the corresponding protein was detected by ELISPOT technique. They respectively reflect the levels of humoral immunity and cellular immunity after vaccine immunization. The result shows: Ag85B, the chimeric subunit vaccine of ESAT-6 and the fusion subunit vaccine group of Ag85B-ESAT-6 compare, the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to Ag85B-ESAT-6 embedded protein vaccine, which is matched with agent MPL-TDM to immunize mouse, to make the IgG2a / IgG1 and IFN- gamma discharge higher then Ag85B-ESAT-6 fusion protein, while later one can generate same protective effect as BCG after infected by bacillus tubercle.

Description

technical field [0001] The present invention relates to the field of genetic engineering and the field of new vaccine development. Specifically, the present invention provides a novel protein polypeptide vaccine of Mycobacterium tuberculosis, which is to insert the esat-6 gene of Mycobacterium tuberculosis into the ag85b gene, express Ag85B, ESAT- 6 chimeric subunit vaccines. Background technique [0002] Tuberculosis still poses a huge threat to mankind. According to WHO statistics, there are about 8 million to 10 million new cases every year, and up to 3 million patients die from tuberculosis every year. Tuberculosis has become the world's number one infectious disease killer. [0003] my country is one of the 22 countries with a high burden of tuberculosis in the world, and the number of tuberculosis patients ranks second in the world. In 2000, according to the analysis of the results of the fourth national tuberculosis epidemiological sampling survey in my country, th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/04C07K14/35C12N15/62A61P31/06
Inventor 王洪海徐颖王宝林王庆忠陈嘉臻祝秉东王九玲郄亚卿
Owner FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com