Recombination albumen of GLP-1 and analogue thereof and human lysozyme fusion and application thereof

A technology of human lysozyme and fusion protein, which can be applied in the directions of drug combination, peptide/protein composition, and medical preparations containing active ingredients, etc., can solve the problem of unforeseeable dual biological activity of fusion protein and so on.

Inactive Publication Date: 2007-03-14
DALIAN D N BIO ENG
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The inventors of this patent did not foresee the dual biological activity of the human lysozyme / GLP-1 fusion protein itself, and the resulting "human lysozyme / GLP-1 fusion protein" contains human lysozyme, GLP-1 and linker In addition to the peptide sequence, it also contains at least one enzyme cleavage site between human lysozyme and GLP-1

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombination albumen of GLP-1 and analogue thereof and human lysozyme fusion and application thereof
  • Recombination albumen of GLP-1 and analogue thereof and human lysozyme fusion and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] The method for expressing the "lowering blood sugar peptide 1-connecting peptide-human lysozyme" fusion protein in Pichia pastoris comprises the following specific steps:

[0070] (1) Obtain the gene encoding the sequence of "lowering blood sugar peptide 1-GGSGGS"

[0071] ①Synthetic primers EX-F1 and EX-R1

[0072] EX-F1: 5' tactcgagaaaagacatggtgaaggaacatttaccagtgacttgtcaaaacagatggaagaggaggcagtgcgg3' (SEQ ID NO. 7)

[0073] EX-R1: 5' atggatccacctgagccacccgatggcggagggtgccccgctacttggtcctccgttcttaagccactcaataaataaccgcactgcctcctcttcc3' (SEQ ID NO. 8)

[0074] ② The above two primers were annealed and extended according to the following reaction conditions to obtain the gene encoding the sequence of "lowering blood sugar peptide 1-GGSGGS"

[0075] The total volume of the reaction system is 50 μl, which contains 4 μl of dNTP (the concentration of each of the four nucleotides is 2.5 mM), 1 μl of each of the above two primers at 25 μM, 0.3 μl of Ex Taq DNA polymerase (includ...

Embodiment 2

[0097] The method for expressing the "lowering blood sugar peptide 2-connecting peptide-human lysozyme" fusion protein in Pichia pastoris, except for the primers used in step (1), the rest of the steps are the same as the steps of the technical solution described in Example 1 .

[0098] In this example, the primers used to obtain the gene encoding the "lowering blood sugar peptide 2-GGSGGS" sequence are G-A-F1 and G-R1:

[0099] G-A-F1: 5'tactcgagaaaagacatgctgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc3'; (SEQ ID NO.9)

[0100] G-R1: 5'atggatccacctgagccacctcggcctttcaccagccaagcaatgaattccttggcagcttggccttccaaataag3'; (SEQ ID NO.10)

Embodiment 3

[0102] The method for expressing the fusion protein of "lowering blood sugar peptide 3-connecting peptide-human lysozyme" in Pichia pastoris, except for the primers used in step (1), the rest of the steps are the same as the steps of the technical solution described in Example 1 .

[0103] The primers used in this example to obtain the gene encoding the "lowering blood sugar peptide 3-GGSGGS" sequence are G-G-F1 and G-R1:

[0104] G-G-F1: 5' tactcgagaaaagacatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc3'; (SEQ ID NO. 11)

[0105] G-R1: 5' atggatccacctgagccacctcggcctttcaccagccaagcaatgaattccttggcagcttggccttccaaataag3'; (SEQ ID NO. 10)

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to recombinant protein of hypoglycemic peptide and human lysozyme and its use. The hypoglycemic peptide in the fusion protein is GLP-1 or its analog and has amino acid sequence of one of those shown in SEQ ID Nos. 1-5; and the human lysozyme has amino acid sequence as shown in SEQ ID No. 6. The hypoglycemic peptide and the human lysozyme are connected in one of the following four connection modes: hypoglycemic peptide-connecting peptide-human lysozyme, hypoglycemic peptide-human lysozyme, human lysozyme-connecting peptide-hypoglycemic peptide and human lysozyme-hypoglycemic peptide. The fusion protein has the hypoglycemic activity of GLP-1 maintained, prolonged half life, as well as anti-infective activity and AGE level-lowering function of human lysozyme, and may be used in preparing medicine for treating diabetes and diabetes complication.

Description

technical field [0001] The present invention relates to recombinant proteins and their applications in the field of pharmacy, in particular to recombinant proteins expressed after fusion of hypoglycemic peptides such as GLP-1 and its analogues with human lysozyme at the gene level, and the fusion proteins of this type in non-insulin-dependent Application in the treatment of diabetes and its complications. Background technique [0002] Glucagon-like peptide-1 (GLP-1) is an intestinal hormone secreted by the human body itself. A short peptide of 30 amino acids is produced. The peptide stimulates insulin secretion by binding to specific receptors on the surface of pancreatic beta cells. There are two forms of GLP-1 in the human body, one is GLP-1(7-36)NH 2 , is a polypeptide composed of 30 amino acid residues, and its C-terminus is amidated; the other is GLP-1(7-37), a polypeptide composed of 31 amino acid residues, GLP-1(7-37) -36)NH 2 And GLP-1 (7-37) have the same insul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N1/19A61K38/16A61P3/10
Inventor黄庆生李元李别虎薛小平张明杰
OwnerDALIAN D N BIO ENG