Recombination albumen of GLP-1 and analogue thereof and human lysozyme fusion and application thereof
A technology of human lysozyme and fusion protein, which can be applied in the directions of drug combination, peptide/protein composition, and medical preparations containing active ingredients, etc., can solve the problem of unforeseeable dual biological activity of fusion protein and so on.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] The method for expressing the "lowering blood sugar peptide 1-connecting peptide-human lysozyme" fusion protein in Pichia pastoris comprises the following specific steps:
[0070] (1) Obtain the gene encoding the sequence of "lowering blood sugar peptide 1-GGSGGS"
[0071] ①Synthetic primers EX-F1 and EX-R1
[0072] EX-F1: 5' tactcgagaaaagacatggtgaaggaacatttaccagtgacttgtcaaaacagatggaagaggaggcagtgcgg3' (SEQ ID NO. 7)
[0073] EX-R1: 5' atggatccacctgagccacccgatggcggagggtgccccgctacttggtcctccgttcttaagccactcaataaataaccgcactgcctcctcttcc3' (SEQ ID NO. 8)
[0074] ② The above two primers were annealed and extended according to the following reaction conditions to obtain the gene encoding the sequence of "lowering blood sugar peptide 1-GGSGGS"
[0075] The total volume of the reaction system is 50 μl, which contains 4 μl of dNTP (the concentration of each of the four nucleotides is 2.5 mM), 1 μl of each of the above two primers at 25 μM, 0.3 μl of Ex Taq DNA polymerase (includ...
Embodiment 2
[0097] The method for expressing the "lowering blood sugar peptide 2-connecting peptide-human lysozyme" fusion protein in Pichia pastoris, except for the primers used in step (1), the rest of the steps are the same as the steps of the technical solution described in Example 1 .
[0098] In this example, the primers used to obtain the gene encoding the "lowering blood sugar peptide 2-GGSGGS" sequence are G-A-F1 and G-R1:
[0099] G-A-F1: 5'tactcgagaaaagacatgctgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc3'; (SEQ ID NO.9)
[0100] G-R1: 5'atggatccacctgagccacctcggcctttcaccagccaagcaatgaattccttggcagcttggccttccaaataag3'; (SEQ ID NO.10)
Embodiment 3
[0102] The method for expressing the fusion protein of "lowering blood sugar peptide 3-connecting peptide-human lysozyme" in Pichia pastoris, except for the primers used in step (1), the rest of the steps are the same as the steps of the technical solution described in Example 1 .
[0103] The primers used in this example to obtain the gene encoding the "lowering blood sugar peptide 3-GGSGGS" sequence are G-G-F1 and G-R1:
[0104] G-G-F1: 5' tactcgagaaaagacatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgcc3'; (SEQ ID NO. 11)
[0105] G-R1: 5' atggatccacctgagccacctcggcctttcaccagccaagcaatgaattccttggcagcttggccttccaaataag3'; (SEQ ID NO. 10)
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com