Multipartite high-affinity nucleic acid probes

a nucleic acid probe and high-affinity technology, applied in the field of nucleic acid analogs and hybridization, can solve the problems of further delay in nucleic acid analysis, high cost and time-consuming for custom synthesis of oligonucleotides

Inactive Publication Date: 2003-04-03
APPL BIOSYSTEMS INC
View PDF17 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0009] It has been discovered that a three-way junction can be stabilized by the introduction of a flexible linker between the portion of the smaller probe that interacts with the target nucleic acid and the portion that interacts with the other smaller probe(s). It has also been discovered that the use of peptide nucleic acids or other nucleic acid analogs that interact more strongly with a strand of DNA than would the complementary strand of DNA can improve the affinity of the smaller probes for each other and for the target nucleic acid. Thus, a stable interaction is possible even where each of the smaller probes is complementary only to a small region of the target nucleic acid (e.g. three to eight nucleotides).

Problems solved by technology

Unfortunately, custom synthesis of oligonucleotides is both expensive and time-consuming: the process may require from 3-6 business days, including ordering, synthesis, and shipping.
Inevitably, analysis of the nucleic acids is further delayed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multipartite high-affinity nucleic acid probes
  • Multipartite high-affinity nucleic acid probes
  • Multipartite high-affinity nucleic acid probes

Examples

Experimental program
Comparison scheme
Effect test

example 1

Synthesis of Probes

[0107] PNA probes may be synthesized at any scale from commercially available reagents and automated synthesizers, following the manufacturers' protocols. Most conveniently, PNA is synthesized at the 2 .mu.mole scale, using Fmoc / Bhoc, tBoc / Z, or MMT protecting group monomers on an Expedite Synthesizer (PE Biosystems) on XAL or PAL support, on the Model 433A Synthesizer (PE Biosystems) on MBHA support, or on other automated synthesizers. After synthesis is complete, the crude PNA is cleaved from the support, e.g. with trifluoroacetic acid, and then precipitated with diethylether and washed twice in diethylether. PNA may be purified by reverse-phase HPLC, analyzed by mass spectroscopy, and quantitated by correlating absorbance at 260 nm with mass.

[0108] Oligonucleotide probes may be synthesized from commercially available (PE Biosystems) nucleoside phosphoramidites (U.S. Pat. No. 4,415,732) and solid supports, e.g. silica, controlled-pore-glass (U.S. Pat. No. 4,458,...

example 2

Detection of a Target Nucleic Acid

[0115] PNA can hybridize to its target complement in either a parallel or anti-parallel orientation. However, the anti-parallel duplex (where the carboxyl terminus of PNA is aligned with the 5' terminus of DNA, and the amino terminus of PNA is aligned with the 3' terminus of DNA) is typically more stable (Egholm, etal (1993) "PNA hybridizes to complementary oligonucleotides obeying the Watson-Crick hydrogen bonding rules", Nature 365:566-68). The PNA FRET probes of the present invention are designed such that the PNA anneals in the anti-parallel orientation with the target sequences.

[0116] PNA molecules ME01 and ME02 were combined with DNA molecule 1057 as a model target:

[0117] GGGCTGGGGCTGGGCAG (SEQ ID NO:1)

[0118] in 50 .mu.L of 100 mM Tris-HCl, pH 8 to form the three-way junction shown in FIG. 7. The final concentration of each PNA and DNA molecule was 1 .mu.M. The mixtures were incubated at 95.degree. C. for 10 minutes and gradually cooled to 37....

example 3

Specificity of the Complex

[0121] PNA molecules ME01 and ME02 were combined either with the complementary DNA molecule 1057, as above, or with DNA molecule 1058:

[0122] GGGCTGCCCTTTCTGGGCAG (SEQ ID NO.2)

[0123] which bears a three nucleotide insertion (mut3bp) when compared to 1057, or with DNA molecule 1059:

[0124] GGGCTCGGGCTGGGCAG (SEQ ID NO.3)

[0125] which bears a single nucleotide substitution (mut1bp). Annealing, electrophoresis and detection were carried out as described in Example 2. Under native conditions, three-way junction complexes were formed for each DNA (FIG. 8, lanes 1-3). Under denaturing conditions (FIG. 9), although the PNA-PNA-DNA complex was clearly evident when the complementary target sequence of 1057 was present (lane 1), no stable complex formation was observed in the presence of the mismatch of 1059 (lane 2) or in the presence of the three nucleotide insertion of 1058 (lane 3). The specificity of two PNA probes each with 7 base first portions hybridizing to tar...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pHaaaaaaaaaa
v/vaaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention provides a collection of probes useful for hybridizing to a target nucleic acid. The probes associate with each other, binding with high affinity to the target nucleic acid, to form three-way junctions and other complexes. At least one of the probes in each collection includes a nucleic acid analog. Methods using the probes in hybridization and as primers are also provided.

Description

[0001] This application is a continuation of pending application Ser. No. 09 / 610,155, filed Jun. 30, 2000, which is incorporated herein by reference.I. FIELD OF THE INVENTION[0002] The present invention generally relates to the fields of nucleic acid analogs and hybridization. More specifically, the invention relates to methods and compositions for hybridization of a collection of probes to a target nucleic acid.II. BACKGROUND[0003] Nucleic acids, such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), are bearers of information. This information, encoded in the ordered nucleotides that constitute the nucleic acids, enables a living system to construct a protein, a cell, or an organism. One specific sequence of nucleotides may be found in a virus, whereas a different sequence may be found in a bacterium, and yet a different sequence in a human being. The detection and analysis of nucleic acids has become one of the most fundamental aspects of diagnostic medicine and medical ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12Q1/68
CPCC12Q1/6818C12Q2525/301C12Q2525/107C12Q2525/161C12Q2525/197C12Q2537/143
InventorEGHOLM, MICHAELCHEN, CAIFU
OwnerAPPL BIOSYSTEMS INC