Check patentability & draft patents in minutes with Patsnap Eureka AI!

Multiparameter FACS assays to detect alterations in cellular parameters and to screen small molecule libraries

a technology of cellular parameters and facs assays, applied in the field of new methods of detecting alterations in cellular parameters and screening libraries of small molecules, can solve the problems of accelerating the accumulation of mutations driving malignant transformation, reducing the background of assays, and increasing specificity

Inactive Publication Date: 2007-07-26
RIGEL PHARMA
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0014] Accordingly, it is an object of the present invention to provide methods for screening for alterations in exocytosis, particularly for screening for agents capable of mediating such exocytosis. It is also an object to provide such screening methods wherein assay background is reduced and specificity is increased.

Problems solved by technology

It is generally fast, and can result in screening large populations of cells in a relatively short period of time.
The loss of cell cycle checkpoint control results in genomic instability, greatly accelerating the accumulation of mutations which drive malignant transformation.
Therapy for allergy remains limited to blocking the mediators released by mast cells (antihistamines), non-specific anti-inflammatory agents such as steroids and mast cell stabilizers which are only marginally effective at limiting the symtomatology of allergy.
Furthermore, it is widely believed that a wide array of psychiatric disorders are the result of an imbalance between neurotransmitter exocytosis and mediator reuptake.
However, this approach is limited by the fact that a single receptor blocker cannot overcome the effects of many diverse mediators.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiparameter FACS assays to detect alterations in cellular parameters and to screen small molecule libraries
  • Multiparameter FACS assays to detect alterations in cellular parameters and to screen small molecule libraries
  • Multiparameter FACS assays to detect alterations in cellular parameters and to screen small molecule libraries

Examples

Experimental program
Comparison scheme
Effect test

example 1

Cell Cycle Assays using p21 as a Positive Control

Materials and Methods:

[0193] Vector Construction: The coding region of the p21 gene was cloned from Jurkat cDNA by PCR with an upstream primer covering the start methionine (5′-GATCGGATCCACC ACCATGGGCTCAGAACCGGCTGGGGATGTC) (SEQ ID NO:46) and C-terminus (5′-GATCCC AATTTAATGGTTTTATTTGTCATCGTCATCCTTGTAGTCGGGCTTCCTCTTGGAGAAGATCAGCC GGCGTTTG) (SEQ ID NO:47). The single PCR product was directionally cloned into the CRU5-GFP retroviral vector (Rigel, Inc.) through flanking BstXI sites within the primers. The resultant construct, CRU5-GFP-p21 F (FIG. 1), encodes the GFP fused (in frame) to the human p21 protein with a Gly insertion at position 2 and a FLAG-epitope at the C-terminus. The C-terminal 24 amino acids of p21 were cloned into the CRU5-GFP retroviral vector (Rigel, Inc.) through flanking BstXI sites within the PCR primers: 5′ GATCCCACCACCATGGGCAAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCC GGCTGATCTTCTCCAA (SEQ ID NO:48); 5′GATCCC...

example 2

Population Based Exocytic Enzyme Activity Measurements

[0197] Materials: All chemicals were obtained from Sigma Chemical Co. Dyes and glucuronide were obtained from Molecular Probes, Inc. Cell lines MC-9 and RBL-2H3 were obtained from American Type Culture Collection (ATCC). Cell culture reagents were obtained from Fisher Scientific and molecular biology reagents from Clontéch Inc.

[0198] Cell Culture: MC-9 cells were maintained as suspension cultures in flasks in media consisting of DMEM with L-arginine (116 mg / ml), L-asparagine (36 mg / ml), sodium pyruvate (1 mM), non-essential amino acids (0.1 mM), folic acid (6 mg / ml), 2-mercaptoethanol (0.05 mM), L-glutamine (2 mM), heat inactivated fetal bovine serum (10%), and 10% T-stim conditioned media (Collaborative Research, Inc.). The cells were kept at a density of between 0.25 and 2×106 / ml. Experiments were only conducted on cells which were greater than 95% viable as determined by trypan blue exclusion. RBL-2H3 cells were maintained a...

example 3

Mast Cell Exocytic Light Scatter Changes

[0203] The cells were prepared as described in Example 2, and light scatter properties were determined.

[0204] Results: The results are shown in FIG. 4. Light scatter changes observed on the flow cytometer (side scatter vs. forward scatter) are plotted as bivariate histograms for RBL-2H3 cells (A, D) and MC-9 cells (B, C, E, F). Cells were stimulated with the ionophore A23187 (0.5 ug / ml) and observed at various timepoints [0 minutes (A, C), 5 minutes (E), 10 minutes (D), and 30 minutes (B, F)]. Time dependent scatter changes are evident in both cell lines with significant changes occurring during the first 10 minutes which represents the major bolus of exocytosis in these cells.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention relates to novel methods of detecting alterations in cell cycle regulation in a cell or a cell population and screening for agents capable of modulating cell cycle regulation through the use of multiparameter assays and a fluorescence-activated cell sorter (FACS) machine.

Description

FIELD OF THE INVENTION [0001] The invention relates to novel methods of detecting alterations in cellular parameters, and particularly for screening libraries of small molecules such as combinatorial chemical libraries of organic molecules, including peptides and other chemical libraries, for binding to target molecules, using fluoroscence-activated cell sorting (FACS) machines. BACKGROUND OF THE INVENTION [0002] The field of drug discovery and screening of drug candidates to identify lead compounds is rapidly expanding. Traditional approaches to identify and characterize new and useful drug candidates include the isolation of natural products or synthetic preparation, followed by testing against either known or unknown targets. See for example WO 94 / 24314, Gallop et al., J. Med. Chem. 37(9):1233 (1994); Gallop et al., J. Med. Chem. 37(10):1385 (1994); Ellman, Acc. Chem. Res. 29:132 (1996); Gordon et al., E. J. Med. Chem. 30:388s (1994); Gordon et al., Acc. Chem. Res. 29:144 (1996);...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C40B30/06C40B40/02C40B40/10G01N33/50
CPCG01N15/147G01N33/5008G01N33/5011G01N2015/149G01N33/502G01N33/5044G01N2015/1477G01N33/5014G01N15/149
Inventor FISHER, JOSEPHLORENS, JAMESPAYAN, DONALDROSSI, ALEXANDER
Owner RIGEL PHARMA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More