Mutant Endoglycoceramidases With Enhanced Synthetic Activity

a technology of endoglycoceramidases and synthetic activity, which is applied in the field of endoglycoceramidases with enhanced synthetic activity, can solve the problems of high cost and low yield, and the transglycosylation activity has not yet been exploited, and achieves the selective selectivity of enzymatic reactions. , the effect of simplifying the synthesis of glycolipids

Inactive Publication Date: 2009-07-02
SENEB BIOSCI +1
View PDF1 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0075]The present invention provides mutant endoglycoceramidase enzymes that have synthetic activity, assembling a saccharide and an aglycone, e.g., a ceramide or sphingosine, to form a glycolipid or a component thereof. The enzymes of the invention exploit the exquisite selectivity of enzymatic reactions to simplify the synthesis of glycolipids.

Problems solved by technology

Because there are no known enzymes that can universally transfer a saccharyl residue to a an aglycone (e.g., ceramide or sphingosine), synthesis of glycolipids usually requires a multi-step complex process that has the disadvantages of high cost and low yield.
This transglycosylation activity has not yet been exploited to synthesize glycolipids, because the far more potent hydrolytic activity of the enzyme counteracts this synthetic activity by quickly hydrolyzing newly made glycolipid.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant Endoglycoceramidases With Enhanced Synthetic Activity
  • Mutant Endoglycoceramidases With Enhanced Synthetic Activity
  • Mutant Endoglycoceramidases With Enhanced Synthetic Activity

Examples

Experimental program
Comparison scheme
Effect test

examples

[0298]The following examples are provided by way of illustration only and not by way of limitation. Those of skill in the art will readily recognize a variety of non-critical parameters that could be changed or modified to yield essentially similar results.

example i

Generating Mutant Endoglycoceramidases

[0299]A synthetic endoglycoceramidase gene was produced by Blue Heron Biotechnology (EGCase1395). Subsequently the gene was subcloned into a pT7-7 expression vector (FIG. 14). Mutations at one of the nucleotides encoding Glu233 of endoglycoceramidase derived from Rhodococcus sp. M-777 (GenBank Accession No. AAB67050, SEQ ID NO:2), were introduced into the EGCase gene by a PCR-based method using five primer sets by combining the same 5′ primer with five different 3′ primers:

The 5′ primer:5 ′CoptAATTCGATTGGATCCCATATGAGCGGAAGCG(SEQ ID NO:26)The 3′ primers:3′Asp PstITCGATTCTGCAGGGAGCCACCAAACGGGTCATTCATCAG(SEQ ID NO:27)3′Gln PstITCGATTCTGCAGGGAGCCACCAAACGGCTGATTCATCAG(SEQ ID NO:28)3′Ala PstI-11-1CGGTCCCTGCAGGGAGCCACCAAACGGCGCATTCATCAG(SEQ ID NO:29)3′Gly PstI-11-1CGGTCCCTGCAGGGAGCCACCAAACGGCCCATTCATCAG(SEQ ID NO:30)3′Ser PstI-11-1CGGTCCCTGCAGGGAGCCACCAAACGGCGAATTCATCAG(SEQ ID NO:31)

[0300]The PCR program used for generating mutations was essentially as...

example ii

Hydrolytic Assays

[0302]An exemplary hydrolytic reaction had a volume of 50 μL, containing 20 μg of substrate (pre-dried lyso-GM2, GM2, or GM3, generated at Neose Technologies, Inc.), 25 μg of Taurodeoxycholic acid (Sigma, Cat # T-0875), 50 mM sodium acetate (pH 5.2), and 5-10 μL of crude cell lysate containing a wild-type or mutant EGCase. The hydrolytic mixture was incubated at 37° C. for 10 to 120 minutes.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Tmaaaaaaaaaa
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
Login to view more

Abstract

The present invention relates to a novel endoglycoceramidase whose hydrolytic activity has been substantially reduced or eliminated, such that the enzyme is useful for synthesis of glycolipids from a monosaccharide or oligosaccharide and a ceramide. More specifically, the endoglycoceramidase is a mutant version of a naturally occurring endoglycoceramidase, preferably comprising a mutation within the active site or the nucleophilic site of the enzyme and more preferably comprising a substitution mutation of the Glu residue within the active site or the nucleophilic site. Also disclosed are a method for generating the mutant endoglycoceramidase and a method for enzymatically synthesizing glycolipids using this mutant enzyme.

Description

CROSS-REFERENCES TO RELATED APPLICATIONS[0001]This application claims the benefit of U.S. Provisional Application 60 / 576,316, filed Jun. 1, 2004; U.S. Provisional Application 60 / 626,791, filed Nov. 10, 2004; and U.S. Provisional 60 / 666,765, filed Mar. 29, 2005, the disclosures of each of which are incorporated herein by reference in their entirety for all purposes.REFERENCE TO THE SEQUENCE LISTING[0002]SEQ ID NO:1: nucleic acid sequence of a wild-type endoglycoceramidase from Rhodococcus sp. M-777. GenBank Accession No. U39554.[0003]SEQ ID NO:2: amino acid sequence of a wild-type endoglycoceramidase from Rhodococcus sp. M-777. GenBank Accession No. AAB67050.[0004]SEQ ID NO:3: nucleic acid sequence of a wild-type endoglycoceramidase from Rhodococcus sp. C9. GenBank Accession No. AB042327.[0005]SEQ ID NO:4: amino acid sequence of a wild-type endoglycoceramidase from Rhodococcus sp. C9. GenBank Accession No. BAB17317.[0006]SEQ ID NO:5: nucleic acid sequence of a wild-type endoglycocera...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(United States)
IPC IPC(8): C12P21/06C12P19/00C12N9/24C12N1/20C12N15/63C07H21/04
CPCC12N9/2402C12P19/26C12Y302/01123
Inventor JOHNSON, KARL F.DEFREES, SHAWNWITHERS, STEPHENVAUGHAN, MARK
Owner SENEB BIOSCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap