Single chain fc fusion proteins

a single-chain fusion protein and fusion protein technology, applied in the field of single-chain fc fusion proteins, can solve the problems of inefficient dimerization or reduction of the half-life of the dimer molecule, immunogenicity and poor pharmacokinetic properties, and loss of bioactivity, so as to improve the properties and improve the bioactivity. , the effect of favorable properties

Inactive Publication Date: 2016-06-23
ALKERMES INC
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention provides better ways to make proteins that fuse the Fc region of an immunoglobulin to other proteins. These new methods use a specific linker that makes the Fc fusion proteins have better properties than other methods. The Fc fusion proteins can be designed to target specific targets with high specificity and affinity.

Problems solved by technology

However, many prior art approaches to Fc fusion protein engineering have limitations including, but not limited to, immunogenicity and poor pharmacokinetic properties.
Steric hindrance can result in losses in bioactivity, inefficient dimerization or reduction in the half-life of the dimer molecule for example, due to reduced binding to the FcRn.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single chain fc fusion proteins
  • Single chain fc fusion proteins
  • Single chain fc fusion proteins

Examples

Experimental program
Comparison scheme
Effect test

example 1

Factor IX

[0164]Design of Factor IX scCLCH1-Fc

[0165]The single chain factor IX molecule contains the factor IX sequence followed by a 10 residue linker having the amino acid sequence: GGGGSGGGGS (SEQ ID NO: 11), the CL domain of IgG1 followed by a 20 residue linker having the amino acid sequence: GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 12) followed by the CHL hinge and Fc portions of human IgG1.

Expression and Characterization of Factor IX scCLCH1-Fc

[0166]The gene, having the following DNA sequence:

(SEQ ID NO: 13)ATGTACCGGATGCAGCTGCTGAGCTGTATCGCCCTGTCTCTGGCCCTCGTGACCAACAGCACCGTGTTTCTGGACCACGAGAACGCCAACAAGATCCTGAACCGGCCCAAGCGGTACAACAGCGGCAAGCTGGAAGAGTTCGTGCAGGGCAACCTGGAACGCGAGTGCATGGAAGAGAAGTGCAGCTTCGAAGAGGCCAGAGAGGTGTTCGAGAACACCGAGCGGACCACCGAGTTCTGGAAGCAGTACGTGGACGGCGACCAGTGCGAGAGCAACCCCTGTCTGAATGGCGGCAGCTGCAAGGACGACATCAACAGCTACGAGTGCTGGTGCCCCTTCGGCTTCGAGGGCAAGAACTGCGAGCTGGACGTGACCTGCAACATCAAGAACGGCAGATGCGAGCAGTTCTGCAAGAACAGCGCCGACAACAAGGTCGTGTGCTCCTGCACCGAGGGCTACAGACTGGCCGAGAACCAGAAGTCCTGCG...

example 2

TNF-R2

[0170]Design of TNF-R2 scCLCH1-Fc

[0171]The single chain TNFR2 molecule contains the TNFR2 sequence followed by a 10 residue linker, GGGGSGGGGS (SEQ ID NO: 11), the CL domain of IgG1 followed by a 20 residue linker GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 12) followed by the CH1, hinge and Fc portions of human IgG1.

Expression of TNF-R2 scCLCH1-Fc

[0172]The gene, having the following DNA sequence:

(SEQ ID NO: 14)ATGTATAGGATGCAGCTCCTCAGCTGCATCGCTCTGTCCCTCGCCCTGGTGACCAACAGCCTCCCTGCCCAGGTGGCCTTTACACCCTACGCTCCTGAGCCCGGAAGCACCTGCAGGCTCAGGGAGTACTACGATCAGACCGCCCAAATGTGTTGCAGCAAGTGCTCCCCTGGCCAGCACGCCAAGGTGTTCTGCACCAAGACAAGCGATACCGTGTGCGATAGCTGTGAGGACAGCACCTACACCCAGCTGTGGAATTGGGTGCCCGAGTGCCTGAGCTGTGGCAGCAGGTGCAGCAGCGATCAGGTGGAGACACAGGCCTGCACCAGAGAGCAGAACAGGATTTGTACCTGCAGGCCCGGCTGGTATTGCGCCCTGAGCAAGCAGGAGGGATGTAGGCTGTGCGCCCCTCTGAGGAAATGCAGACCTGGCTTTGGAGTGGCTAGGCCCGGCACCGAGACATCCGACGTGGTGTGCAAGCCTTGTGCCCCTGGCACCTTTTCCAACACCACCAGCTCCACCGACATCTGCAGGCCCCATCAGATTTGCAACGTGGTGGCCATCCCCGGAAACGCTAGCATGGATGC...

example 3

IL1Ra

[0176]Design of IL1Ra scCLCH1-Fc

[0177]The single chain IL1Ra molecule contains the IL1Ra sequence followed by a 10 residue linker, GGGGSGGGGS (SEQ ID NO: 11), the CL domain of IgG1 followed by a 20 residue linker, GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 12) followed by the CH1, hinge and Fc portions of human IgG1.

Expression of IL1Ra scCLCH1-Fc

[0178]The gene having the following DNA sequence:

(SEQ ID NO: 15)ATGTACCGGATGCAGCTGCTGTCCTGTATCGCCCTGTCTCTGGCCCTGGTCACCAACTCCAGACCCTCTGGCCGGAAGTCCTCCAAGATGCAGGCCTTCCGGATCTGGGACGTGAACCAGAAAACCTTCTACCTGCGGAACAACCAGCTGGTGGCCGGCTATCTGCAGGGCCCCAACGTGAACCTGGAAGAGAAGATCGACGTGGTGCCCATCGAGCCCCACGCCCTGTTTCTGGGAATCCACGGCGGCAAGATGTGCCTGTCCTGCGTGAAGTCCGGCGACGAGACACGGCTGCAGCTGGAAGCCGTGAACATCACCGACCTGTCCGAGAACCGGAAGCAGGACAAGAGATTCGCCTTCATCAGATCCGACTCCGGCCCTACCACCTCCTTCGAGTCTGCTGCTTGCCCCGGCTGGTTCCTGTGCACCGCCATGGAAGCTGACCAGCCCGTGTCCCTGACCAACATGCCTGACGAGGGCGTGATGGTCACCAAGTTCTATTTTCAGGAAGATGAGGGCGGAGGCGGCTCTGGCGGCGGAGGATCTAGAACAGTGGCCGCTCCCTCCGTGTTCATCTTCCCACCTTCCGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The present invention provides novel, single chain Fc fusion proteins having improved properties. The invention provides single chain fusions of soluble proteins fused to the Fc region of an immunoglobulin via a novel linker comprising a constant region of an immunoglobulin light chain linked to a CH1 constant region of an immunoglobulin heavy chain. This novel linker confers favorable properties on the Fc fusion proteins of the invention such as improved bioactivity and increased half-life as compared to non-Fc fusion counterparts or as compared to prior art Fc fusion proteins. The novel Fc fusion protein scaffold as described herein may be designed to include soluble proteins of interest capable of binding or interacting with any target of interest. Preferably, the Fc fusion protein of the invention is a dimer. The dimer preferably forms via a disulfide bond between free cysteine residues in the hinge region of two monomeric Fc fusion proteins of the invention.

Description

RELATED APPLICATION[0001]This application claims the benefit of U.S. Provisional Application No. 62 / 094,242, filed on Dec. 19, 2014. The entire teachings of the above application are incorporated herein by reference.BACKGROUND OF THE INVENTION[0002]One strategy for increasing serum half-life of a therapeutic protein is to attach the protein to an Fc (fragment crystallizable) domain of an antibody. Many such fusion proteins are capable of forming homodimers or heterodimers thereby forming antibody-like fusion protein molecules. However, many prior art approaches to Fc fusion protein engineering have limitations including, but not limited to, immunogenicity and poor pharmacokinetic properties.[0003]The present invention provides monomers and dimers of Fc fusion proteins comprising novel linkers having single chain constant light (CL) and constant heavy (CH1) immunoglobulin domains. Such novel linkers are also referred to herein as scCLCH1 linkers.[0004]Without limitation to a particul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A61K47/48C07K14/715C07K14/55C07K14/565C12N9/64A61K38/17A61K38/20A61K38/21A61K38/48C07K14/705C07K14/54
CPCA61K47/48369C07K2319/70C07K14/7155C07K14/55C07K14/565C07K14/5428A61K38/179A61K38/1793A61K38/2013A61K38/215A61K38/2066A61K38/4846C12N9/644C12Y304/21022C07K2319/30C07K14/70578A61K38/00C07K14/7151A61P1/04A61P13/12A61P17/00A61P17/06A61P25/24A61P27/16A61P35/00A61P37/02A61P37/06A61P43/00A61P7/04A61K47/64
InventorALVAREZ, JUANMOUSTAKAS, DEMETRI T.BRODKIN, HEATHER R.MCSWEENEY, LESLIE A.
OwnerALKERMES INC