Soluble lymphotoxin-beta receptors, anti-lymphotoxin receptor antibodies, and use of anti-lymphotoxin ligand antibodies

A lymphotoxin, soluble technology, applied in the blocking agent of β-lymphotoxin receptor, the field of β-lymphotoxin receptor extracellular domain, can solve the problem of not being suitable for long-term treatment and so on

Inactive Publication Date: 2008-04-23
BIOGEN IDEC MA INC
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

They are therefore not suitable for long-term treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Soluble lymphotoxin-beta receptors, anti-lymphotoxin receptor antibodies, and use of anti-lymphotoxin ligand antibodies
  • Soluble lymphotoxin-beta receptors, anti-lymphotoxin receptor antibodies, and use of anti-lymphotoxin ligand antibodies
  • Soluble lymphotoxin-beta receptors, anti-lymphotoxin receptor antibodies, and use of anti-lymphotoxin ligand antibodies

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0223] Preparation of Soluble Human LTβ Receptor Forming Fusion Protein with Immunoglobulin Fc

[0224] Sequences from somatic hybrid human cDNA clones isolated from the human 12p transcript sequence library (Baens et al. Genome , 16, pp. 214-18 (1993), was entered into a gene library and was later identified as the sequence encoding human LTβ-R. Since 1992, the full-length human LTβ-R cDNA clone sequence is available, and its gene bank accession number is LO 4270.

[0225] Use primers with Not I and Sal I restriction enzyme sites at the 5' and 3' ends to amplify to the extracellular region of the transmembrane region LTβ-R ( figure 1 ) (Browning et al., Journal of Immunology , 154, pp. 33-46 (1995)). The amplified fragment was cut with Not I and Sal I, purified and ligated with the Sal I-Not I fragment encoding the human IgG1 Fc region into the Not I linearized vector PMDR901. The final vector contains the dihydrofolate reductase gene and the LTβR-Ig fusion protein dri...

Embodiment 2

[0228] Preparation of soluble murine LTβ receptor as a fusion protein with immunoglobulin Fc.

[0229] The 5'Not I / Apal I and 3'Apal I / Not I fragments from two partial cDNA isolates were ligated into the Not I site of PCDNA 3 (Invitrogen, San Diego, CA) to make a complete copy of the murine LTβ-R. cDNA cloning. The sequence of this cDNA clone can be obtained through GenBank accession number U29173. Compared with another murine LTβ-R sequence entered into the GenBank accession number L38423, no differences in the coding sequence were found.

[0230] Using the full-length m LTβ-R cDNA clone as a template, the soluble mouse LTβ-R / human IgG1 fusion protein was synthesized by PCR amplification with primers 5'AACTGCAGCGGCCGCCATGCGCCTGCCC3' and 5'GACTTTGTCGACCATTGCTCCTGGCTCTGGGGG 3'. The purified and Not I and Sal I cleaved amplified fragment was ligated together with the Sal I / Not I fragment of human IgG1 Fc to Not I linearized and phosphatase-treated SAB 132 to form JLB122. For ...

Embodiment 3

[0232] Immunohistochemical analysis of spleens after multiple injections of mice with LTβ-R-Ig

[0233] Mice aged 4-5 weeks received 6 injections of LTβ-R-Ig or LFA-3-Ig (100 ug, ip) once a week, and these mice were immunized with SRBC on the day of the 6th injection of the fusion protein. Day 4 after challenge with SRBC; one more injection of LTβ-R-Ig or LFA-3-Ig. Mice were sacrificed on day 10 after SRBC challenge and organs were harvested for analysis of their structure. figure 2 The left column in represents the spleen section (A, C, E, G, I) from LFA-3-Ig treatment animal; The right column represents the spleen section (B, D, F, H) from LTβ-R-Ig treatment animal , J). Acetone-fixed frozen spleen sections (A and B) were double-stained with biotinylated anti-mouse B220 and anti-mouse CD40 antibodies, followed by corresponding alkaline phosphate-labeled streptavidin (purple blue, dark staining) ) and horseradish peroxidase-labeled mouse anti-rat Ig (light brown staining)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Compositions and methods comprising "beta-lymphotoxin receptor blocking agents" that block beta-lymphotoxin receptor signaling and are used to modify immunological diseases, particularly antibody-mediated immune responses.

Description

[0001] invention technical field [0002] The present invention relates to compositions and methods comprising "beta-lymmotoxin receptor blockers" that block beta-lymmotoxin receptor signaling. Beta-lymphotoxin receptor blocking agents are useful in the treatment of immune diseases, more specifically in the inhibition of antibody-mediated immune responses, in the regulation of addressin expression and cellular trafficking, and in affecting the differentiation of nodular dendritic cells. The invention also relates to soluble forms of the ectodomain of the beta-lymphotoxin receptor, and antibodies raised against the beta-lymmotoxin receptor or its ligand, surface lymphotoxin, which act as blocking agents for the beta-lymmotoxin receptor . Background of the invention [0003] Acquired immunity consists of two components that can act in conjunction to achieve the common goal of clearing antigens, but they are mediated by different parts of the immune system to achieve different e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/395A61K38/17A61K38/55C07K19/00A61P37/00A61K45/00A61K31/7008A61K38/00A61P31/18A61P37/02C07K14/715C07K16/24C07K16/28
CPCC07K16/2878C07K16/241C07K16/2866C07K2319/00A61K38/00C07K14/7151C07K2319/30A61P13/12A61P21/04A61P31/12A61P31/18A61P37/00A61P37/02Y02A50/30A61K39/395
InventorJ·布朗宁P·S·霍克曼P·D·伦纳特F·麦凯
OwnerBIOGEN IDEC MA INC