Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

80 results about "Receptor signaling" patented technology

Organic compounds

The invention relates to particular substituted heterocycle fused gamma-carbolines, their prodrugs, in free, solid, pharmaceutically acceptable salt and / or substantially pure form as described herein, pharmaceutical compositions thereof, and methods of use in the treatment of diseases involving the 5-HT2A receptor, the serotonin transporter (SERT), pathways involving the dopamine D1 and D2 receptor signaling system, and / or the μ-opioid receptor.
Owner:INTRA CELLULAR THERAPIES INC

Regulatable cell surface receptors and related compositions and methods

Provided herein are cell surface receptors that include an extracellular binding domain, a transmembrane domain, an intracellular signaling domain, and a protease cleavage site disposed between the extracellular binding domain and the intracellular signaling domain. In certain aspects, the cell surface receptors are engineered cell surface receptors, such as chimeric antigen receptors (CARs). Also provided are cells that include such receptors (e.g., where the cells express the receptors on their surface) and pharmaceutical compositions including such cells. Nucleic acids that encode the cell surface receptors, cells including such nucleic acids, and pharmaceutical compositions including such cells, are also provided. Also provided are methods for regulating signaling of a cell surface receptor, and methods of using the cells of the present disclosure, including methods of using such cells to administer a regulatable cell-based therapy to an individual.
Owner:THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIV

Combination therapies for metabolic disease

Provided herein are methods of treating metabolic disorders, including cardiometabolic disorders such as heart failure with preserved ejection fraction (HFpEF), by co-administering therapeutically effective amounts of: an isolated nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:12) or a sequence at least 95% identical thereto, wherein the nucleic acid is RNA, and wherein the nucleic acid is at most 30 nt long; and a second therapeutic that is an incretin or functional analogue thereof, and / or is an activator of glucagon-like peptide 1 (GLP-1) receptor signaling.
Owner:CEDARS SINAI MEDICAL CENT

Ketamine derivatives and their use in treatment of mental disorders

The invention discloses a ketamine derivative and application thereof in treatment of mental diseases, and belongs to the technical field of medicines. The compound or the pharmaceutical composition thereof provided by the invention can obviously improve the expression quantity of nerve cells BDNF, promote the growth of neurite, inhibit NMDA receptor signals and treat acute and chronic depression, has improved oral bioavailability compared with ketamine, and can be used for treating mental diseases such as depression.
Owner:SHANGHAI DONGXI ZHIHUI BIOLOGICAL MEDICINE CO LTD

Epigenetics method for improving cryopreservation efficiency of sheep semen

The invention discloses an epigenetics method for improving the cryopreservation efficiency of sheep semen. The method comprises the following steps: extracting seminal fluid of Donflilien and Hu sheep hybrid F1-generation sheep, dividing the seminal fluid into a fresh group and a frozen group, carrying out somatic cell removal and small non-coding RNA extraction, screening out differentially expressed microRNAs by utilizing a Pandorah sequencing technology, analyzing a target gene and a signal channel of the microRNAs, and determining the seminal fluid of the Donflilien and Hu sheep hybrid F1-generation sheep. The small non-coding RNA related to sperm cryopreservation is found to mainly relate to key biological processes such as oxidative stress response and cell surface receptor signal channels. The screened differentially expressed small non-coding RNA is added into the frozen semen through methods such as in vitro chemical synthesis, so that the artificial fertilization conception rate of the frozen semen is remarkably increased.
Owner:INNER MONGOLIA UNIVERSITY

Application of baclofen in preparation of medicine for treating glioma

The invention discloses application of baclofen in preparation of a medicine for treating glioma, and belongs to the technical field of biological medicine. Through systematic in-vitro and in-vivo experiments, it is proved for the first time that baclofen (especially R-configuration) has a remarkable anti-tumor effect on glioma including temozolomide (TMZ) drug resistance. The invention not only provides a brand-new clinical strategy for treating TMZ drug-resistant glioma, but also shows important value in the field of scientific research: baclofen can be used as a valuable tool compound and is used for exploring a new function of a GABAB receptor signal channel in glioma progress and drug resistance; meanwhile, a key tool is provided for constructing a stable TMZ drug-resistant model, the high-throughput drug screening and evaluation efficiency can be remarkably improved, and the TMZ drug-resistant monoclonal antibody can serve as a positive control drug to accelerate the conversion process from basic research of glioma to clinical application and has wide scientific research application prospects and conversion potential.
Owner:NANJING MEDICAL UNIV

Pharmaceutical application of artemisia plant essential oil

The invention belongs to the field of plant essential oil, and particularly relates to pharmaceutical application of artemisia plant essential oil. The specific technical scheme is as follows: according to the pharmaceutical application of the artemisia plant essential oil, the artemisia plant essential oil is extracted from wormwood growing above 2000 m, and can inhibit or lower TNF signal channels, interaction between cell factors and cell factor receptors, NOD-like receptor signal channels, Toll-like receptor signal channels, cell adhesion molecule signal channels and other channels, so that the artemisia plant essential oil can be used for inhibiting or lowering the TNF signal channels, the interaction between the cell factors and the cell factor receptors, the NOD-like receptor signal channels, the Toll-like receptor signal channels, the cell adhesion molecule signal channels and the like. Therefore, wound healing is promoted, inflammation is resisted, and scar hyperplasia is reduced or avoided.
Owner:LIANGSHAN PLATEAU AIWANG BIOTECHNOLOGY CO LTD

Method of preventing and treating type 1 diabetes, allograft rejection and lung fibrosis (by targeting the ATP / p2x7r axis)

PendingUS20260248770A1PurineFibrosis
The present invention relates to the role of purinergic receptors and ATP in T cell activation and autocrine system signaling. In one embodiment, the present invention provides a method of preventing or treating diabetes by administering a therapeutically effective inhibitor of ATP to a subject. In another embodiment, the present invention provides a method of preventing or treating fibrosis by administering a P2X7R soluble fusion protein. In another embodiment, the present invention provides a method of preventing or treating graft rejection by administering an inhibitor of P2X receptor signaling.
Owner:CHILDRENS MEDICAL CENT CORP

Application of alkaloid bicuculline in liver fibrosis resistance

The invention provides an application of alkaloid bicuculline in preparation of a medicine for preventing and / or treating hepatic fibrosis diseases and hepatic inflammation, and also provides an application of bicuculline in preparation of an inflammatory factor expression inhibitor and an application of bicuculline in preparation of a Toll-like receptor 4 signal channel inhibitor. 7.5 mu g / mL of bicuculline can be used for relieving the activation of hepatic stellate cells induced by TGF-beta1, remarkably reducing the expression of alpha-SMA and COL1A1, and reducing the expression of MyD88 and NF-kB as well as downstream inflammatory factors IL-6, IL-1beta and TNF-alpha in a TLR4 / MyD88 / NF-kB signal channel. By intraperitoneal injection treatment of 0.6 mg / kg of bicuculline, the liver morphology in a fibrosis model can be remarkably improved, the levels of ALT and AST in serum can be remarkably reduced, and collagen deposition and expression of alpha-SMA and COL1A1 in the liver can be remarkably reduced.
Owner:SHANXI MEDICAL UNIV

Application of ANXA1 protein or antagonist thereof in preparation of medicine for treating multiple myeloma

The invention provides an application of an ANXA1 protein or an antagonist thereof in preparation of a medicine for treating multiple myeloma. After the multiple myeloma BCMA immunotherapy, when BCMA negative recurrence occurs, in multiple myeloma cells, a BCMA receptor signal channel is reduced, ANXA1 protein expression quantity is increased, proliferation of the multiple myeloma cells is promoted, and CAR-T cell immunocompetence and immune persistence are inhibited at the same time. The antagonist of the ANXA1 protein reduces the expression quantity of the ANXA1 protein, inhibits the proliferation of multiple myeloma cells, and recovers the immunocompetence and immune persistence of CAR-T cells at the same time. According to the application, the biological function of the ANXA1 in the MM cells is defined, the action mechanism of the ANXA1 antagonist for treating the BCMA negative MM cells and improving the activity of the CAR-T cells is proved, a valuable theoretical basis is provided for improvement of clinical myeloma CAR-T cell treatment, and finally the disease-free lifetime of a patient after BCMA-targeted immunotherapy is prolonged.
Owner:RUIJIN HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE

Traditional Chinese medicine composition for treating ischemic heart failure and preparation method thereof

The invention relates to a traditional Chinese medicine composition for treating ischemic heart failure and a preparation method thereof, and belongs to the field of traditional Chinese medicine pharmacy, and the traditional Chinese medicine composition is prepared from the following raw material medicines in parts by weight: 5-15 parts of cassia twig, 5-15 parts of bighead atractylodes rhizome, 5-15 parts of poria cocos, 6-12 parts of rhizoma zingiberis, 5-15 parts of acanthopanax, 10-30 parts of fructus polygoni orientalis, 3-9 parts of verbena, 6-12 parts of dogwood and 3-9 parts of honey-fried licorice root. The composition can remarkably reduce the level of N-terminal proB-type natriuretic peptide, remarkably improve pathological changes of heart tissues of model rats, regulate and control the heart functions of the model rats, improve the systolic function of the heart, relieve expression of inflammatory factors such as interleukin-1beta, interleukin-6 and tumor necrosis factor-alpha of the rats and improve the anti-inflammatory effect of the rats. The action mechanism of the compound relates to a plurality of pathways such as extracellular matrix receptor interaction, a chemotactic factor signal pathway, a relaxin signal pathway, a cyclic adenosine monophosphate signal pathway, a nuclear factor-kB signal pathway, fatty acid metabolism and a Toll-like receptor signal pathway, and the compound is an effective medicament for treating ischemic heart failure.
Owner:FIRST PEOPLES HOSPITAL OF YUNNAN PROVINCE

Application of IGF2BP2-m6A-VCAN-TLR2 signal axis in preparation of medicine for treating lymphatic metastasis of intrahepatic cholangiocarcinoma

ActiveCN122005811AOrganic active ingredientsInorganic active ingredientsNode metastasisInsulin-like growth factor-binding protein
The invention discloses application of an IGF2BP2-m6A-VCAN-TLR2 (Insulin-like Growth Factor 2BP2-m6A-VCAN-TLR2) signal axis in preparation of a medicine for treating lymphatic metastasis of intrahepatic cholangiocarcinoma. Aiming at the problems of unknown lymphatic metastasis mechanism and lack of effective targets of intrahepatic cholangiocarcinoma, the invention discovers and verifies that mRNA binding protein 2 of insulin-like growth factor 2 is modified by m6A to regulate and control the expression of pluripotent proteoglycan so as to activate a Toll-like receptor 2 signal, promote macrophages to secrete vascular endothelial growth factor C and drive a brand new pathway of lymphatic metastasis. Based on this, the invention provides an inhibitor targeting the signal axis, especially a small molecule compound 8010-8498. Experiments show that the compound can significantly inhibit migration, invasion and epithelial-mesenchymal transition of bile duct cancer cells, reduce macrophage secretion of vascular endothelial growth factors C, effectively inhibit tumor growth and lymphatic metastasis in a nude mouse popliteal lymph node metastasis model and a spontaneous bile duct cancer model, and present a synergistic effect when combined with gemcitabine and cis-platinum.
Owner:THE FIRST AFFILIATED HOSPITAL OF WENZHOU MEDICAL UNIV

Establishment method and application of rat acute inflammation model for simulating clinical inflammation

The invention discloses an establishment method and application of a rat acute inflammation model for simulating clinical inflammation, and relates to the technical field of biology. According to the invention, lipopolysaccharide is taken as a modeling drug, continuous intraperitoneal injection is carried out on a rat at the dosage of 20-40 [mu] g / kg, 30-50 [mu] g / kg and 40-60 [mu] g / kg for three days, and expression and release of interleukin-6 are promoted by activating a Toll-like receptor 4 signal channel, so that the acute inflammation model of the rat is established. The established rat acute inflammation model can cause significant increase of inflammatory biomarkers such as interleukin-6, C-reactive protein and alpha1 acid glycoprotein on the basis of not causing rat liver and kidney injury, and is more similar to clinical acute inflammation states; and a new experimental animal model is provided for exploring the influence of acute inflammation on pharmacokinetics of drugs.
Owner:YANTAI UNIV

Organic compounds

This invention relates to particular substituted heterocycle fused gamma-carbolines, their prodrugs, in free, solid, pharmaceutically acceptable salt and / or substantially pure form as described herein, pharmaceutical compositions thereof, and methods of use in the treatment of diseases involving 5-HT2A receptor, serotonin transporter (SERT) and / or pathways involving dopamine D1 / D2 receptor signaling systems, and / or the treatment of residual symptoms.
Owner:INTRA CELLULAR THERAPIES INC

Conditionally activated receptor signaling by use of scaffold proteins

The present invention relates to one or more binding molecules capable of inducing receptor signaling of a receptor complex under conditions of non-competitive and / or two-site binding to a scaffold protein. The invention also relates to the therapeutic use of said one or more binding molecules in cancer and autoimmune diseases.
Owner:CHUGAI PHARMA CO LTD

Use of IGF2BP2-m6A-VCAN-TLR2 signal axis in preparation of drugs for treating intrahepatic cholangiocarcinoma lymph node metastasis

ActiveCN122005811BNode metastasisInsulin-like growth factor-binding protein
The application discloses an IGF2BP2-m6A-VCAN-TLR2 signal axis in the preparation of a drug for treating intrahepatic cholangiocarcinoma lymphatic metastasis. In view of the problems of unknown intrahepatic cholangiocarcinoma lymphatic metastasis mechanism and lack of effective target, the application finds and verifies a new pathway that from insulin-like growth factor 2 mRNA binding protein 2, m6A modification regulates the expression of multi-functional proteoglycan, and then activates Toll-like receptor 2 signal, promotes macrophage secretion of vascular endothelial growth factor C and drives lymphatic metastasis. Based on this, the application provides an inhibitor targeting the signal axis, in particular, a small molecule compound 8010-8498. Experiments show that the compound can significantly inhibit cholangiocarcinoma cell migration, invasion and epithelial mesenchymal transition, reduce macrophage secretion of vascular endothelial growth factor C, and effectively inhibit tumor growth and lymphatic metastasis in a naked mouse popliteal lymph node metastasis model and a spontaneous cholangiocarcinoma model. The compound presents a synergistic effect in combination with gemcitabine and cisplatin.
Owner:THE FIRST AFFILIATED HOSPITAL OF WENZHOU MEDICAL UNIV

Anti-interleukin-23 P19 antibodies and methods of use thereof

The present disclosure provides antibodies and antibody fragments thereof that bind to IL-23p19. The disclosed antibodies and antibody fragments thereof can modulate a biological activity of the IL-23 receptor signaling axis and are therefore useful for the treatment of immune-mediated inflammatory disorders.
Owner:NOVAROCK BIOTHERAPEUTICS LTD

Combination of macrophage-directed immunotherapy and cytokines for treatment of cancer

PendingUS20260015419A1Antibody mimetics/scaffoldsPeptide/protein ingredientsCancer preventionSignal-regulatory protein alpha
The present disclosure provides methods and compositions related to the combination therapy of a macrophage-directed immunotherapy and a cytokine (e.g., IL-10). The combination of the macrophage-directed immunotherapy and a cytokine is useful in treating and / or preventing cancer (e.g., lung cancer) in a subject. Therapies that activate macrophages are emerging in cancer immunotherapy. One potential therapeutic target is the CD47-SIRPa, interaction, which acts as a myeloid immune checkpoint. Cluster of Differentiation 47 (CD47) is highly expressed on many different types of cancer cells, including lung cancer cells. CD47 binds to an inhibitory receptor, signal regulatory protein alpha (SIRPa,), that is expressed on the surface of macrophages and other myeloid immune cells.
Owner:WHITEHEAD INST FOR BIOMEDICAL RES +1

Salts and Solid Forms of Compounds with APJ Receptor Activity

The present disclosure relates to salts and solid forms of compounds that modulate APJ receptor activity and their use as therapeutic agents for treating diseases, disorders, or conditions associated with suppression or impairment of APJ receptor signaling, such as pulmonary arterial hypertension (PAH).
Owner:ANNAPURNA BIO INC

Compounds and compositions for treating diseases associated with APJ receptor activity

The present disclosure features modulating (e.g., agonizing) an apelin receptor (also referred to herein as an APJ receptor; in particular, the present invention relates to chemical entities (e.g., compounds or pharmaceutically acceptable salts and / or hydrates of compounds and / or prodrugs of compounds) that have a molecular marker APLNR (e.g., a gene symbol APLNR). The disclosure also features compositions comprising the chemical entities, as well as other methods of use and preparation. The chemical entities are useful, for example, in the treatment of a subject (e.g., a human) having a disease, disorder or condition in which APJ receptor activity is reduced (e.g., APJ receptor signaling is hindered or impaired; e.g., apelin-APJ receptor signaling is hindered or impaired) or down-regulation of endogenous apelin contributes to the pathology and / or symptom and / or progression of the disease, disorder or condition. Non-limiting examples of these diseases, disorders or conditions include: (i) cardiovascular disease; (ii) a metabolic disorder; (iii) diseases, conditions and conditions associated with vasopathology; (iv) organ failure; (v) diseases, disorders, and conditions associated with infection (e.g., microbial infection); (vi) a disease, disorder or condition of a sequelae or complication of any of the foregoing or disclosed herein. More specific non-limiting examples of these diseases, disorders or conditions include pulmonary arterial hypertension (e.g., PAH); heart failure; type II diabetes; renal failure; , sepsis and systemic hypertension.
Owner:ANNAPURNA BIO INC

Target-binding molecules for conditionally activated receptor signaling

PCT designated stageWO2026054039A1FungiBacteriaBinding domainScaffold protein
The present invention relates to one or more target-binding molecules, each comprising a binding domain [S1] and a binding domain [S2] that are each capable of binding to a scaffold protein, a binding domain [R1] that is capable of binding to a first receptor protein, and a binding domain [R2] that is capable of binding to a second receptor protein. The target-binding molecule is capable of inducing receptor signaling of a receptor complex, conditioned upon binding to a scaffold protein.
Owner:CHUGAI PHARMA CO LTD

Application of taurine in promoting litopenaeus vannamei larvae to adapt to low-salinity water body

The invention discloses an application of taurine in promoting litopenaeus vannamei larvae to adapt to a low-salinity water body, taurine is used as a survival and growth promoter for feeding the larvae, and the influence on the adaptive capacity under the low-salinity condition, including survival rate, body length, tissue structure, cell proliferation and osmotic pressure regulation capacity, is explored. Research finds that taurine promotes the adaptive capacity of litopenaeus vannamei larvae in a low-salinity water body, which shows that the taurine significantly improves the survival rate and body length of the larvae; after the taurine is added, muscle fibers of the young shrimps are tighter, and tissue boundaries are clearer; transcriptomics results show that taurine negatively regulates a Wnt pathway to promote proliferation of epithelial cells of the young shrimps, and receptor signals coping with external stimulation and response gene expression are reduced; the taurine also relieves the NKA enzyme activity and protein expression level induced by the low-salinity water body. Therefore, the taurine can be used as a survival and growth promoter for improving the adaptive capacity of the litopenaeus vannamei larvae in a low-salinity water body.
Owner:HUAZHONG AGRI UNIV