114 results about "Receptor signaling" patented technology

The invention discloses an intercellular signal transduction inference method and device based on optimal transmission of a knowledge graph, equipment and a medium, and relates to the technical field of genetic engineering. The source gene expression data of different cells in the source cell type and the target gene table data of different cells in the target cell type are found according to the cell type database. On the basis of the ligand-receptor interaction knowledge graph, obtaining various pathways with an interaction relationship between the source cell type and the target cell type, and constructing a pathway set; and with the aim of minimizing the total transmission cost, determining an optimal transmission cost matrix of each path in the path set by adopting an scKGOT algorithm. According to the method, the intercellular channel can be more conveniently deduced, and the intercellular communication can be deduced by accurately simulating the intercellular ligand-receptor signal channel.

The invention relates to particular substituted deuterated heterocycle fused gamma-carbolines, their prodrugs, in free, solid, pharmaceutically acceptable salt and / or substantially pure form as described herein, pharmaceutical compositions thereof, and methods of use in the treatment of diseases involving 5-HT2A receptor, serotonin transporter (SERT) and / or pathways involving dopamine D1 / D2 receptor signaling systems, and / or the treatment of residual symptoms.

The present disclosure relates to compounds, compositions, and methods for treating diseases or disorders that are associated with aberrant tumor necrosis factor receptor 1 (TNFR1) signaling.

The invention relates to particular substituted heterocycle fused gamma-carbolines, their prodrugs, in free, solid, pharmaceutically acceptable salt and / or substantially pure form as described herein, pharmaceutical compositions thereof, and methods of use in the treatment of diseases involving the 5-HT2A receptor, the serotonin transporter (SERT), pathways involving the dopamine D1 and D2 receptor signaling system, and / or the μ-opioid receptor.

Provided herein are cell surface receptors that include an extracellular binding domain, a transmembrane domain, an intracellular signaling domain, and a protease cleavage site disposed between the extracellular binding domain and the intracellular signaling domain. In certain aspects, the cell surface receptors are engineered cell surface receptors, such as chimeric antigen receptors (CARs). Also provided are cells that include such receptors (e.g., where the cells express the receptors on their surface) and pharmaceutical compositions including such cells. Nucleic acids that encode the cell surface receptors, cells including such nucleic acids, and pharmaceutical compositions including such cells, are also provided. Also provided are methods for regulating signaling of a cell surface receptor, and methods of using the cells of the present disclosure, including methods of using such cells to administer a regulatable cell-based therapy to an individual.

The invention relates to a particular enantiomer of a substituted heterocycle fused gamma-carboline, in free, solid, pharmaceutically acceptable salt and / or substantially pure form as described herein, pharmaceutical compositions thereof, and methods of use in the treatment of diseases involving the 5-HT2A receptor, and pathways involving the dopamine D1 and D2 receptor signaling system.

Natural killer cells engineered to express a chimeric antigen receptor (CAR) having a Toll / interleukin-1 (IL-1) receptor (TIR) signaling domain, such as a Toll-like receptor (TLR) signaling domain or an IL-1 receptor (IL-1 R) subfamily signaling domain, are provided. Compositions and methods for making and using the natural killer cells in immunotherapy for cancer are also provided. And the CAR-NK cell can be a CISH <-> / -iPSC-NK cell.

The invention relates to a particular substituted heterocycle fused gamma-carboline, in free, or pharmaceutically acceptable salt, and / or substantially pure form as described herein, pharmaceutical compositions thereof, and methods of use in the treatment of diseases involving the 5-HT2A receptor, the serotonin transporter (SERT), and / or pathways involving the dopamine D1 and D2 receptor signaling system.

Provided herein are methods of treating metabolic disorders, including cardiometabolic disorders such as heart failure with preserved ejection fraction (HFpEF), by co-administering therapeutically effective amounts of: an isolated nucleic acid comprising a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO:12) or a sequence at least 95% identical thereto, wherein the nucleic acid is RNA, and wherein the nucleic acid is at most 30 nt long; and a second therapeutic that is an incretin or functional analogue thereof, and / or is an activator of glucagon-like peptide 1 (GLP-1) receptor signaling.

The invention discloses a ketamine derivative and application thereof in treatment of mental diseases, and belongs to the technical field of medicines. The compound or the pharmaceutical composition thereof provided by the invention can obviously improve the expression quantity of nerve cells BDNF, promote the growth of neurite, inhibit NMDA receptor signals and treat acute and chronic depression, has improved oral bioavailability compared with ketamine, and can be used for treating mental diseases such as depression.

The invention relates to a method of predicting an outcome of a subject having a glioma, comprising determining or receiving the result of a determination of a first gene expression profile for each of one or more immune defense response genes, and / or of a second gene expression profile for each of one or more T-Cell receptor signaling genes, and / or of a third gene expression profile for each of one or more PDE4D7 correlated genes, said first, second, and third expression profile(s) being determined in a biological sample obtained from the subject, determining the prediction of outcome based on the first gene expression profile(s), or on the second gene expression profile(s), or on the third gene expression profile(s), or on the first, second, and third gene expression profile(s), and, optionally, providing the prediction to a medical caregiver or the subject.

The invention features methods of treating a transfusion dependent subject having myelofibrosis, a cytopenia associated with myelofibrosis, such as anemia, thrombocytopenia, or neutropenia, or receiving treatment with a cytopenia-associated myelofibrosis treatment by administering to the subject an activin receptor type II (ActRII) signaling inhibitor, optionally in combination with a cytopenia- associated myelofibrosis treatment. The ActRII signaling inhibitor may be an antibody that binds to an ActRII ligand, an ActRII antibody, or an ActRII ligand trap.

The invention relates to particular substituted heterocycle fused gamma-carbolines, in free, solid, pharmaceutically acceptable salt and / or substantially pure form as described herein, pharmaceutical compositions thereof, and methods of use in the treatment of diseases involving the 5-HT2A receptor, the serotonin transporter (SERT), pathways involving the dopamine D1 and D2 receptor signaling system, and / or the μ-opioid receptor.

The invention discloses an epigenetics method for improving the cryopreservation efficiency of sheep semen. The method comprises the following steps: extracting seminal fluid of Donflilien and Hu sheep hybrid F1-generation sheep, dividing the seminal fluid into a fresh group and a frozen group, carrying out somatic cell removal and small non-coding RNA extraction, screening out differentially expressed microRNAs by utilizing a Pandorah sequencing technology, analyzing a target gene and a signal channel of the microRNAs, and determining the seminal fluid of the Donflilien and Hu sheep hybrid F1-generation sheep. The small non-coding RNA related to sperm cryopreservation is found to mainly relate to key biological processes such as oxidative stress response and cell surface receptor signal channels. The screened differentially expressed small non-coding RNA is added into the frozen semen through methods such as in vitro chemical synthesis, so that the artificial fertilization conception rate of the frozen semen is remarkably increased.

The invention discloses application of baclofen in preparation of a medicine for treating glioma, and belongs to the technical field of biological medicine. Through systematic in-vitro and in-vivo experiments, it is proved for the first time that baclofen (especially R-configuration) has a remarkable anti-tumor effect on glioma including temozolomide (TMZ) drug resistance. The invention not only provides a brand-new clinical strategy for treating TMZ drug-resistant glioma, but also shows important value in the field of scientific research: baclofen can be used as a valuable tool compound and is used for exploring a new function of a GABAB receptor signal channel in glioma progress and drug resistance; meanwhile, a key tool is provided for constructing a stable TMZ drug-resistant model, the high-throughput drug screening and evaluation efficiency can be remarkably improved, and the TMZ drug-resistant monoclonal antibody can serve as a positive control drug to accelerate the conversion process from basic research of glioma to clinical application and has wide scientific research application prospects and conversion potential.

The present disclosure provides antibodies and antibody fragments thereof that bind to IL-25. The antibodies and antibody fragments thereof of the present disclosure can modulate the biological activity of the IL-25 / IL-25 receptor signaling axis, and thus are useful in the treatment of type 2 inflammatory diseases, autoimmune diseases, allergic diseases, or cancers.

The invention belongs to the field of plant essential oil, and particularly relates to pharmaceutical application of artemisia plant essential oil. The specific technical scheme is as follows: according to the pharmaceutical application of the artemisia plant essential oil, the artemisia plant essential oil is extracted from wormwood growing above 2000 m, and can inhibit or lower TNF signal channels, interaction between cell factors and cell factor receptors, NOD-like receptor signal channels, Toll-like receptor signal channels, cell adhesion molecule signal channels and other channels, so that the artemisia plant essential oil can be used for inhibiting or lowering the TNF signal channels, the interaction between the cell factors and the cell factor receptors, the NOD-like receptor signal channels, the Toll-like receptor signal channels, the cell adhesion molecule signal channels and the like. Therefore, wound healing is promoted, inflammation is resisted, and scar hyperplasia is reduced or avoided.

The present invention relates to the role of purinergic receptors and ATP in T cell activation and autocrine system signaling. In one embodiment, the present invention provides a method of preventing or treating diabetes by administering a therapeutically effective inhibitor of ATP to a subject. In another embodiment, the present invention provides a method of preventing or treating fibrosis by administering a P2X7R soluble fusion protein. In another embodiment, the present invention provides a method of preventing or treating graft rejection by administering an inhibitor of P2X receptor signaling.

The present invention provides adoptive T cell therapy with improved structures for targeting antigens and recruiting multimeric immune signaling complexes to treat, prevent, or ameliorate at least one symptom of cancer, infectious disease, autoimmune disease, inflammatory disease, and immune deficiency, or conditions associated therewith. The present disclosure relates generally to engineered immune receptor complexes capable of recognizing a target antigen and recruiting and activating natural or transgenic immune receptor signaling complexes, e.g., T cell receptor (TCR) signaling complexes, polynucleotides and polypeptides encoding same, compositions thereof, and methods of making and using same to treat a disorder or disease (e.g., cancer or autoimmunity).

The invention provides an application of alkaloid bicuculline in preparation of a medicine for preventing and / or treating hepatic fibrosis diseases and hepatic inflammation, and also provides an application of bicuculline in preparation of an inflammatory factor expression inhibitor and an application of bicuculline in preparation of a Toll-like receptor 4 signal channel inhibitor. 7.5 mu g / mL of bicuculline can be used for relieving the activation of hepatic stellate cells induced by TGF-beta1, remarkably reducing the expression of alpha-SMA and COL1A1, and reducing the expression of MyD88 and NF-kB as well as downstream inflammatory factors IL-6, IL-1beta and TNF-alpha in a TLR4 / MyD88 / NF-kB signal channel. By intraperitoneal injection treatment of 0.6 mg / kg of bicuculline, the liver morphology in a fibrosis model can be remarkably improved, the levels of ALT and AST in serum can be remarkably reduced, and collagen deposition and expression of alpha-SMA and COL1A1 in the liver can be remarkably reduced.

The invention provides an application of an ANXA1 protein or an antagonist thereof in preparation of a medicine for treating multiple myeloma. After the multiple myeloma BCMA immunotherapy, when BCMA negative recurrence occurs, in multiple myeloma cells, a BCMA receptor signal channel is reduced, ANXA1 protein expression quantity is increased, proliferation of the multiple myeloma cells is promoted, and CAR-T cell immunocompetence and immune persistence are inhibited at the same time. The antagonist of the ANXA1 protein reduces the expression quantity of the ANXA1 protein, inhibits the proliferation of multiple myeloma cells, and recovers the immunocompetence and immune persistence of CAR-T cells at the same time. According to the application, the biological function of the ANXA1 in the MM cells is defined, the action mechanism of the ANXA1 antagonist for treating the BCMA negative MM cells and improving the activity of the CAR-T cells is proved, a valuable theoretical basis is provided for improvement of clinical myeloma CAR-T cell treatment, and finally the disease-free lifetime of a patient after BCMA-targeted immunotherapy is prolonged.

The invention relates to a traditional Chinese medicine composition for treating ischemic heart failure and a preparation method thereof, and belongs to the field of traditional Chinese medicine pharmacy, and the traditional Chinese medicine composition is prepared from the following raw material medicines in parts by weight: 5-15 parts of cassia twig, 5-15 parts of bighead atractylodes rhizome, 5-15 parts of poria cocos, 6-12 parts of rhizoma zingiberis, 5-15 parts of acanthopanax, 10-30 parts of fructus polygoni orientalis, 3-9 parts of verbena, 6-12 parts of dogwood and 3-9 parts of honey-fried licorice root. The composition can remarkably reduce the level of N-terminal proB-type natriuretic peptide, remarkably improve pathological changes of heart tissues of model rats, regulate and control the heart functions of the model rats, improve the systolic function of the heart, relieve expression of inflammatory factors such as interleukin-1beta, interleukin-6 and tumor necrosis factor-alpha of the rats and improve the anti-inflammatory effect of the rats. The action mechanism of the compound relates to a plurality of pathways such as extracellular matrix receptor interaction, a chemotactic factor signal pathway, a relaxin signal pathway, a cyclic adenosine monophosphate signal pathway, a nuclear factor-kB signal pathway, fatty acid metabolism and a Toll-like receptor signal pathway, and the compound is an effective medicament for treating ischemic heart failure.

The invention discloses application of an IGF2BP2-m6A-VCAN-TLR2 (Insulin-like Growth Factor 2BP2-m6A-VCAN-TLR2) signal axis in preparation of a medicine for treating lymphatic metastasis of intrahepatic cholangiocarcinoma. Aiming at the problems of unknown lymphatic metastasis mechanism and lack of effective targets of intrahepatic cholangiocarcinoma, the invention discovers and verifies that mRNA binding protein 2 of insulin-like growth factor 2 is modified by m6A to regulate and control the expression of pluripotent proteoglycan so as to activate a Toll-like receptor 2 signal, promote macrophages to secrete vascular endothelial growth factor C and drive a brand new pathway of lymphatic metastasis. Based on this, the invention provides an inhibitor targeting the signal axis, especially a small molecule compound 8010-8498. Experiments show that the compound can significantly inhibit migration, invasion and epithelial-mesenchymal transition of bile duct cancer cells, reduce macrophage secretion of vascular endothelial growth factors C, effectively inhibit tumor growth and lymphatic metastasis in a nude mouse popliteal lymph node metastasis model and a spontaneous bile duct cancer model, and present a synergistic effect when combined with gemcitabine and cis-platinum.

The invention discloses an establishment method and application of a rat acute inflammation model for simulating clinical inflammation, and relates to the technical field of biology. According to the invention, lipopolysaccharide is taken as a modeling drug, continuous intraperitoneal injection is carried out on a rat at the dosage of 20-40 [mu] g / kg, 30-50 [mu] g / kg and 40-60 [mu] g / kg for three days, and expression and release of interleukin-6 are promoted by activating a Toll-like receptor 4 signal channel, so that the acute inflammation model of the rat is established. The established rat acute inflammation model can cause significant increase of inflammatory biomarkers such as interleukin-6, C-reactive protein and alpha1 acid glycoprotein on the basis of not causing rat liver and kidney injury, and is more similar to clinical acute inflammation states; and a new experimental animal model is provided for exploring the influence of acute inflammation on pharmacokinetics of drugs.

The present disclosure relates to forms (e.g., salt forms and / or crystalline forms) of a compound of structure (I): Formula (I), and pharmaceutical compositions comprising the forms, methods of preparing the forms, and methods for using the forms, e.g., to treat diseases, such as cancer, or conditions involving dysregulated immune response or other disorders associated with aberrant AhR signaling.

Antibodies that modulate insulin receptor signaling are provided.

This invention relates to particular substituted heterocycle fused gamma-carbolines, their prodrugs, in free, solid, pharmaceutically acceptable salt and / or substantially pure form as described herein, pharmaceutical compositions thereof, and methods of use in the treatment of diseases involving 5-HT2A receptor, serotonin transporter (SERT) and / or pathways involving dopamine D1 / D2 receptor signaling systems, and / or the treatment of residual symptoms.

The present invention relates to one or more binding molecules capable of inducing receptor signaling of a receptor complex under conditions of non-competitive and / or two-site binding to a scaffold protein. The invention also relates to the therapeutic use of said one or more binding molecules in cancer and autoimmune diseases.

The present disclosure relates to antibodies that bind to and agonize human LAG-3, and to methods for treating autoimmune disease, thereby promoting T-cell receptor signaling downregulation. Methods of making and using said agonistic antibodies also are disclosed, especially for use in the prevention, down-regulation and / or amelioration of autoimmune and / or immune tolerance related disorders.