Expression method of interleukin 24 from yeast cell
A technology for expression of interleukin and yeast, which is applied in the field of yeast cell expression of human interleukin 24, which can solve the problems of unguaranteed biological activity and short-term effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0027] 1. Clone the whole gene of human IL-24:
[0028]Take 5ml of anticoagulated blood from a healthy person, collect the buffy coat with lymphocyte separation medium; wash twice with Hank's solution, add RPMI 1640 complete medium and ConA with a total concentration of 25μg / ml, incubate at 37°C, 5% CO2 for 48h; centrifuge Collect human peripheral blood mononuclear cells, extract total RNA; synthesize IL-24cDNA from mRNA, reverse transcription conditions are 30°C for 10s, 50°C for 30s, 99°C for 5s, 5°C for 5s, 1 cycle. The three primers are:
[0029] P1: 5'CGGCATATGAATTTTCAACAGAGGC3', containing EcoR1 restriction site;
[0030] P2: 5'CCATGGCGGCCCAGGGCCAAGAATTCC3', containing EcoR1 restriction site;
[0031] P3: 5'GGATCCTTACAGAGCTTGTAGAATTTCTG3', containing Not1 restriction site;
[0032] Use a pair of primers P1 and P3 to carry out PCR reaction, the conditions are: 94°C for 5min, 94°C for 1min, 55°C for 1min, 72°C for 1min, 30 cycles; 72°C for 10min to amplify smIL-24 or mI...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap