Expression method of interleukin 24 from yeast cell

A technology for expression of interleukin and yeast, which is applied in the field of yeast cell expression of human interleukin 24, which can solve the problems of unguaranteed biological activity and short-term effect

Inactive Publication Date: 2008-04-23
ARMY MEDICAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The current literature on the expression of IL-24 shows that in foreign countries, it focuses on the transient expression of IL-24 in tumor cells mediated by adenovirus, and the effect of inducing cell apoptosis is very significant. There are problems, first, the safety of adenovirus, Second, the effect is short-lived
There are two domestic literatures, one is the expression of inclusion bodies in E. coli, the disadvantage is that the expression of inclusion bodies and no protein post-translational modification, biological activity cannot be guaranteed; the other is transient expression in COS cells, there is also a short-term effect The problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression method of interleukin 24 from yeast cell
  • Expression method of interleukin 24 from yeast cell
  • Expression method of interleukin 24 from yeast cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] 1. Clone the whole gene of human IL-24:

[0028]Take 5ml of anticoagulated blood from a healthy person, collect the buffy coat with lymphocyte separation medium; wash twice with Hank's solution, add RPMI 1640 complete medium and ConA with a total concentration of 25μg / ml, incubate at 37°C, 5% CO2 for 48h; centrifuge Collect human peripheral blood mononuclear cells, extract total RNA; synthesize IL-24cDNA from mRNA, reverse transcription conditions are 30°C for 10s, 50°C for 30s, 99°C for 5s, 5°C for 5s, 1 cycle. The three primers are:

[0029] P1: 5'CGGCATATGAATTTTCAACAGAGGC3', containing EcoR1 restriction site;

[0030] P2: 5'CCATGGCGGCCCAGGGCCAAGAATTCC3', containing EcoR1 restriction site;

[0031] P3: 5'GGATCCTTACAGAGCTTGTAGAATTTCTG3', containing Not1 restriction site;

[0032] Use a pair of primers P1 and P3 to carry out PCR reaction, the conditions are: 94°C for 5min, 94°C for 1min, 55°C for 1min, 72°C for 1min, 30 cycles; 72°C for 10min to amplify smIL-24 or mI...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

Expression of human interleukin 24 from yeast cell is carried out by cloning IL-24 gene or IL-24 gene with base mutation, constructing them onto three expression carriers pPIC3.5K, pPIC9K or pA0815, obtaining eight expression carriers, using His-pichia GS115, KM71 or SMD1168 as host cell, endocellular soluble expressing or exocellular secretory expressing, and obtaining expression human interleukin 24. It achieves stable, higher efficiency and biological activity and correct space structure of IL-24.

Description

technical field [0001] The invention relates to the technical field of producing protein medicine by recombinant DNA technology, in particular to a method for expressing human interleukin-24 in yeast cells. Background technique [0002] In 1995, Pau1.B.Fisher of Columbia University discovered a new melanoma differentiation-associated gene, mda-7 (melanoma differentiation-associated gene 7), in the cDNA library of melanoma cells by subtractive hybridization method, and preliminary experiments proved that mda -7 has anti-proliferative properties of melanoma and the ability to promote terminal differentiation during melanoma progression. Subsequently, mda-7 has been studied as a tumor suppressor until 2002, when Caudell et al. used a series of experiments to confirm the cytokine properties of mda-7, and proposed to rename mda-7 as interleukin-24 (interleukin-24, IL -24), belonging to the IL-24 family. [0003] The IL-24 gene is located on human chromosome 1q32.2-1q41, with 7 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/81C12N15/24C12N15/66C12P21/02
Inventor 邹全明杨珺
Owner ARMY MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap