Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Staphylococcus aureau DNA vaccine pcDNA3.1(+)-Minigene and its prepn process

A DNA vaccine, staphylococcus technology, applied in antibacterial drugs, pharmaceutical formulations, gene therapy and other directions, can solve the problems of combined use and other problems that have not been found, and achieve the effects of enhanced immune protection, broad development prospects, and simple preparation.

Inactive Publication Date: 2007-11-07
JIANGSU FEIYA CHEM IND
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The above two candidate antigens have relevant research reports showing that their protein vaccines can effectively stimulate the body to produce specific antibodies, but there is no report on the combined use of these two antigens as a vaccine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Staphylococcus aureau DNA vaccine pcDNA3.1(+)-Minigene and its prepn process
  • Staphylococcus aureau DNA vaccine pcDNA3.1(+)-Minigene and its prepn process
  • Staphylococcus aureau DNA vaccine pcDNA3.1(+)-Minigene and its prepn process

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment one: Staphylococcus aureus DNA vaccine pcDNA3.1(+)-Minigene and its preparation method 1. The artificial synthesis of Minigene: According to, the ligand binding motif (D1 of FnBP 21-34 ; D3 20-33 ) and the gene sequence of 12 amino acids at the C-terminus of the TRAP protein, the sequence of the designed recombinant fusion gene is as follows:

[0036] CAAGGTGGCAATATCGTAGATATCGATTTTGATAGTGTACCTCAATTCGGTGGACACAATAGTGTTGACTTTGAAGAAGATACAAGTTATTTTGAAAGATATCTATACCCAATAAAAGAA

[0037] Design upstream and downstream primers according to the above gene for artificial synthesis:

[0038] Upstream primers:

[0039]5'-CAAGGTGGCAATATCGTAGATATCGATTTTGATAGTGTACCTCAATTCGGTGGACACAATAGTGTTGACT-3'

[0040] Downstream primers:

[0041] 5'-TTCTTTTATTGGGTATAGATATCTTTCAAAATAACTTGTATCTTTCTTCAAAGTCAACACTATTGTGTCCA-3'

[0042] Mutual templates were used for PCR amplification to obtain a 120bp Minigene gene. The amplified product was recovered and purified.

[0043] 2. Construc...

Embodiment 2

[0050] Example 2: Evaluation of the immune effect of DNA vaccine pcDNA3.1(+)-Minigene 1 Mass preparation of plasmid DNA

[0051] (1) Resuspend each 250ml of culture with 150ml of ice-precooled STE, centrifuge at 8000rpm at 4°C for 6min, discard the supernatant, and store the cells at -20°C;

[0052] (2) Get a certain amount of thalline and resuspend with 300ml solution I, OD is about 10;

[0053] (3) Add 600ml of newly prepared solution II, gently invert 4-6 times to mix well, and place at room temperature for 5-10min;

[0054] (4) Add 300ml of solution III pre-cooled with ice, gently invert 4-6 times to mix, place on ice for 10min; centrifuge at 10,000rpm at 4°C for 30min, discard the precipitate, and filter the supernatant with gauze;

[0055] (5) Add 0.6 times the volume of isopropanol, let stand at room temperature for 10 minutes; centrifuge at room temperature (25°C) at 12000 g for 15 minutes; carefully discard the supernatant, invert it on a paper towel, and remove the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to one kind of staphylococcus aureus DNA vaccine pcDNA3.1(+)-Minigene and its preparation process. Immunological mouse test shows that the staphylococcus aureus DNA vaccine pcDNA3.1(+)-Minigene of the present invention can stimulate mouse body to generate obvious and lasting specific lymphopoiesis reaction and humoral immunity in certain level and in obvious difference (P<0.05) to that of pcDNA3.1 inoculating negative control group. In addition, the toxicity antagonizing test shows that pcDNA3.1(+)-Minigene plasmid can induce mouse to generate staphylococcus aureus resisting antibody to protect the immunized mouse.

Description

technical field [0001] The invention relates to a staphylococcus aureus DNA vaccine pcDNA3.1(+)-Minigene and a preparation method thereof. Background of the invention [0002] The emergence of DNA vaccines is the third revolution in the history of vaccine development. As a new type of vaccine, DNA vaccine can stimulate both antibody response and CTL response. It uses genetic recombination technology to directly recombine the foreign gene (DNA) encoding a certain antigenic protein with the plasmid, and then directly introduces it into animal cells, and synthesizes the antigenic protein through the transcription system of the host cell, inducing the host to produce the antigenic protein. immune response to prevent and treat disease. Compared with traditional inactivated vaccines, subunit vaccines and genetically engineered vaccines, DNA vaccines have the following advantages: ① enhanced immune protection; ② simple preparation, saving time and effort; ③ homogeneous cross prot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61P31/04
Inventor 陈宇光倪继祖沈彦萍
Owner JIANGSU FEIYA CHEM IND
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com