Glair NRBP having important functions in regulating and controlling in immunoregulation
A protein and immune-regulating technology, applied in peptide/protein components, medical preparations containing active ingredients, anti-tumor drugs, etc., can solve problems such as difficulties in new drug development and lack of R&D systems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0072] Embodiment 1 Obtaining of NRBP gene
[0073] Using PCR technology, the following primers were used to obtain a DNA fragment of about 1.6 kb in the human Jurkat cDNA library (purchased from Clonetech), and the PCR product was recovered and connected to the T-easy vector (purchased from Promega).
[0074] Forward primer (SEQ ID NO: 1):
[0075] 5'ggccaa tccggcc atgtcggggggggagtcccagacagtac 3'
[0076] Reverse primer (SEQ ID NO: 2):
[0077] 5'ggcctctaaggcc ctaagaggagacggtgacagcggcggctga 3'
[0078] The part in italics is the Sfi I restriction linker sequence used for the convenience of downstream cloning. After sequencing, a 1608bp fragment was obtained, and after Blast sequence comparison, it was confirmed that the fragment was the sequence of the open reading frame (ORF) part of NRBP.
Embodiment 2
[0079] Example 2 Yeast two-hybrid screening for proteins interacting with NRBP
[0080] The method described in Example 1 was used to obtain the full length of the NRBP gene by PCR technology, and was transferred to the transformed fusion plasmid pGBKT7-BD vector containing BD function through the shuttle of the Sfi I cloning site (the pGBKT7-BD vector was purchased from Clontech Company, Added Sfi I restriction site) in its multiple cloning site) and connected as bait, screened HELA cDNA library (purchased from Clonetech Company) and lymphocyte cDNA library (purchased from Clonetech Company) by yeast two-hybrid system, the positive obtained The clones were sequenced and identified as Jab1 and Hax1, and two clones of Jab1 were obtained.
[0081] The full-length Jab1 and Hax1 genes (Jab1: GenBank accession number, NM_006837; Hax1, GenBank accession number, NM_006118) were obtained by conventional PCR technology, and transferred to the transformed fusion plasmid pGADT7- AD (pGA...
Embodiment 3
[0083] Example 3 Validation of the interaction between NRBP and Hax1 in mammalian cells
[0084] Obtain the full-length of NRBP and Hax1 gene by PCR technology, through SfiI cloning site, they are respectively combined with the transformed eukaryotic expression vector pCDEF containing Flag, HA and other tags (pCDEF plasmid is purchased from Clontech, and the described transformation is to use conventional method Add SfiI site) in the multiple cloning site of pCDEF) and connect, and the obtained plasmid co-transfects mammalian 293 T cells (purchased from ATCC) by the calcium phosphate method. After 24 hours, the cells are broken, and the supernatant of the lysate is collected. Anti-Flag, HA tag antibodies (anti-Flag, anti-HA; purchased from Roche Company) were used to determine whether they were co-precipitated.
[0085] The results of immunoprecipitation (IP) are shown in Figure 1. The inventor's experimental results proved that NRBP and Hax1 transiently transfected in 293 ce...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More