Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!
Newcastle disease virus LAMP detection reagent case and detection method thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A detection kit and technology for Newcastle disease virus, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of high detection cost, heavy workload and cumbersomeness, and achieve high sensitivity and specificity. Effect
Active Publication Date: 2011-06-01
扬州良德抗体生物科技有限公司
View PDF0 Cites 1 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
These methods take a long time to report results and require a lot of work
However, the commonly used polymerase chain reaction (PCR) technology requires special instruments, and has the disadvantages of easy cross-contamination and cumbersome operation.
Although fluorescent real-time quantitative polymerase chain reaction (real time PCR) technology has solved the problem of cross-contamination and simplified the operation process, it needs more complex quantitative measurement instruments, so it is not suitable for rapid on-site detection. Higher, it also increases the difficulty of promotion and application
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Examples
Experimental program
Comparison scheme
Effect test
Embodiment Construction
[0035] The following examples further illustrate the invention, but should not be construed as limiting the invention.
[0036] The loop-mediated isothermal amplification detection kit for Newcastle disease virus was prepared according to the following formula:
[0037] (1) LAMP reaction solution A:
[0038] Contains 10× isothermal reaction buffer, AMV 8U / μl, Rnasin 40U / μl, Bst DNA polymerase 8U / μl, 10mM dNTP, 100mM magnesium sulfate, 20μM inner primer 1, 20μM inner primer 2, 10μM outer primer 1, 10μM outer Primer 2 and 5M betaine, wherein:
[0040] Internal primer 1 is: TCCTTAAGCCGGAGGATGTTGGTTTTGCAACAGCTGCACAGATAAC
[0041] The inner primer 2 is: ACTGACGGATTATCACAACTAGCTTTTGGTCATTAACAAACTGCTGCA
[0042] Outer primer 1 is: TTATYGGYRGTGTRGCTCT
[0043] The outer primer 2 is: TCRGTTAGGTAYARGTTGAG
[...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention relates to a reagent box and a detecting method for quickly detecting newcastle disease virus by using loop-mediated isothermal amplification (LAMP) technique, which comprises 10 x isothermal reaction buffer solution, AMV 8U / Mul, Rnasin 40U / Mul, Bst DN polymerase 8U / Mul, 10mM dNTP, 100mM magnesium sulphate, 20 Mu M inner primer 1, 20Mu M inner primer 2, 10Mu M outer primer 1, 10Mu outer primer 2, the reaction solution A of 5M betaine, and the reaction solution B of the betaine: 1000 x fluorescent dye SYBR Green I. By extracting the RNA of tissue sample as well as the RNA in the poultry throat and cloaca cotton swab sample, conducting the loop-mediated isothermal amplification of newcastle disease virus, and detecting the coloration of the amplified products, the newcastle disease virus can be detected. By eliminating the defects in prior art, such as time-consuming quality, large workload, cross contamination and complex operations, the reagent box and the detecting method for quickly detecting newcastle disease virus has the advantages of strong specificity, high sensitiveness, good speed, low cost, simpler operating methods, and perfect applicability to quick detection at site.
Description
technical field [0001] The invention belongs to the field of biotechnology, and relates to a kit for rapidly detecting Newcastle disease virus using a loop-mediated isothermal amplification (LAMP) technology, and a method for rapidly detecting Newcastle disease virus using the kit. Background technique [0002] Newcastle disease (ND) is an acute and highly contagious poultry disease caused by Newcastle disease virus (NDV), which is a serious hazard to the poultry industry. The World Organization for Animal Health (OIE) lists it as a statutory notifiable infectious disease, and my country also defines it as a first-class animal infectious disease. [0003] With the development of highly intensive poultry farming, the control of ND has attracted much attention. The on-site diagnosis of ND mainly relies on the comprehensive judgment of history, clinical symptoms, pathological changes and epidemiological investigation, which has brought overload work to the majority of veterina...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.