Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Eriocheir sinensis lipotropism polyoses factor gene and encoding protein and application

An anti-lipopolysaccharide factor, the technology of Chinese mitten crab, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of Chinese mitten crab breeding industry loss, various serious diseases, etc.

Inactive Publication Date: 2008-08-20
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, with the continuous expansion of the breeding scale, various diseases are becoming more and more serious, which has caused huge losses to the Chinese mitten crab farming industry.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Eriocheir sinensis lipotropism polyoses factor gene and encoding protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0014] A cloned Chinese mitten crab anti-lipopolysaccharide factor has the following sequence:

[0015] Sequence Listing (1) Information of SEQ ID NO 1

[0016] sequence feature

[0017] Length: 700 base pairs

[0018] Type: nucleic acid

[0019] Chain type: double chain

[0020] Topology: Linear

[0021] Molecule type: DNA

[0022] Feature Name: CDS(21-383)

[0023] Source: Eriocheir sinensis

[0024] Sequence description:

[0025] GAATTCGTCAAACCACCAGTATGGCACGCCTGTCGCTGTTCCTTCTCG

[0026] TTGTGGCTGTTGCCGTGTTTACTCCAAACATTCCACAGTGTGAAGCTG

[0027] GCTGGCTGGACCGGATTATTGGTACAGCAGTTGATTCTGTTGCTGAAT

[0028] TCGGAACCACTAATAGTGGACCAAATCTGCAACACCCGTGTGATGC

[0029] CCACCATAAAGAAGTTTGAACTGTACTTCAGGGGGAGAGTGTGGTGC

[0030] CCAGGCTGGACAACAATCCAGGGGGAGTCTCTGACTCGCAGCAGGAC

[0031] CAGGGTGGTGAACAAAGCTGTGGAAGACTTCGCCAGGAAGGCTGTC

[0032] GCTGCAGGCCTCATGACGCAGGAGGATGCTAACCCTTTGCTGAATGCC

[0033] TGATCATGGAGCAGGACGCCACACCTCTGGGGCACATGGCTATCCTGA

[0034] CCCATGTGTCCTTCATCTGCCA...

Embodiment 2

[0103] The recombinant expression product of the anti-lipopolysaccharide factor gene of the mitten crab can be used as an animal feed additive, a food preservative, a food preservation agent or a medicine for treating human septicemia.

[0104] polysaccharide factor.txt

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to an Eriocheir sinensis anti-lipopolysaccharide factor gene cloning and in vitro recombinant expression technology of molecular biology, and the Eriocheir sinensis anti-lipopolysaccharide factor gene has the base sequence in a sequence table of SEQ ID No: 1. The Eriocheir sinensis anti-lipopolysaccharide factor is studied by utilizing a constructed Eriocheir sinensis cDNA library and adopting the RACE technology and the in vitro recombinant expression technology, the cDNA sequence of the anti-lipopolysaccharide factor is cloned from the Eriocheir sinensis for the first time, the gene has the sequence which is indicated in the sequence table, and the prokaryotic recombinant technology is utilized for expressing a recombinant protein with stronger bactericidal activity.

Description

technical field [0001] The present invention relates to molecular biology Chinese mitten crab anti-lipopolysaccharide factor gene cloning and in vitro recombination expression technology, specifically, the cDNA complete sequence of the Chinese mitten crab anti-lipopolysaccharide factor gene is cloned from the Chinese mitten crab cDNA library The prokaryotic recombinant expression of the sequence is carried out, and the application of the gene and its expression product in the production of medicine, feed additive, antiseptic and fresh-keeping agent and treatment of human septicemia is also involved. Background technique [0002] The prevention and treatment of septic shock caused by bacterial endotoxin has been difficult to achieve important breakthroughs for a long time, and its morbidity and mortality are still on the rise. A variety of proteins have been found to neutralize endotoxin, such as polymyxin B (PMB), bactericidal permeability-enhancing protein (BPI), etc. Howev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/435A23K1/16A23L1/03A23L3/3526A61K38/17A61P31/04A61P7/00A23K20/153A23L29/00
Inventor 宋林生李成华赵建民邱丽梅
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com