Unlock instant, AI-driven research and patent intelligence for your innovation.

Spray containing small molecule disturbance ribonucleic acid

A molecular ribonucleic acid and small molecule interference technology, applied in the field of bioengineering technology, can solve problems such as high cost, increased siRNA concentration, and reduced bioavailability

Inactive Publication Date: 2008-09-03
祝加贝
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If the siRNA is directly injected into the blood, firstly, the function of the siRNA is to be transported into the cells, which is currently considered to be a passive transport; second, due to the half-life of the siRNA in the blood circulation, its bioavailability is reduced; from the previous The first and second problems lead to a third problem, which is to increase the concentration of siRNA in the blood, and the resulting side effects are more worrying, and the cost is quite high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Spray containing small molecule disturbance ribonucleic acid
  • Spray containing small molecule disturbance ribonucleic acid
  • Spray containing small molecule disturbance ribonucleic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Embodiment 1 Materials and methods

[0071] 1. Experimental materials

[0072] Recipient cell lines: baby mouse kidney cell line (BHK-21) and canine kidney cell line (MDCK) (purchased from Shanghai Kunken Biochemical Co., Ltd., product numbers are QK10311, QK10124 respectively);

[0073] Virus isolates: FMDV (foot-and-mouth disease virus), FMO (subtype O), FMA (subtype A), FMAsia (subtype Asia). Influenza virus (influenza virus) InfA (subtype A) (purchased from American Type Culture Collection (ATCC), preservation number is ATCC VR-1331)

[0074] Liposome: cholesterol 10%, lecithin 35%, phosphatidylethanolamine 35%, phosphatidylserine 10%, phosphoinositide 4,5 bisphosphate (PtdIns(4,5)P2) 10%.

[0075] Primers for Q-RE-PCR:

[0076] For the amplification of FMDV 3D forward primer: 5'ACACCAGAGATGTGGAAG3'

[0077] For the amplification of FMDV 3D reverse primer: 5'GACGGCATTCCGCCTTCAAC3'

[0078] For the amplification of influenza virus PA reverse primer: 5'GAAGGAAGAG...

Embodiment 2

[0093] Embodiment 2 silencing effect

[0094] 1. Hysteresis and reduction of cytopathic effect (CPE)

[0095] The cells in this example are all fibroblasts, growing in a single layer and arranged regularly. After virus infection, it causes a significant cytopathic effect (CPE), and total cell detachment, suspension, and destruction can be observed by microscopy.

[0096] Baby mouse kidney cell line (BHK-21) has been widely used in the diagnosis of FMDV and virus identification. The MDCK cell line is used for viral immunization against influenza virus.

[0097] In order to study the effect of siRNA / shRNA silencing on virus infection, 100 TCID 50 The FMDV FMO, FMA, FMAsia each subtype virus infection transfected BHK-21 cells (24 hours after transfection), the InfA virus strain that the multiplicity of infection (MOI) is 0.01 will infect the transfected MDCK cells (transfection 18 hours later).

[0098] figure 1 , 2 3 and 3 are photographs taken of representative clear reg...

Embodiment 3

[0141] Embodiment 3 virus titer reduces

[0142] In this example, four kinds of viruses were used to infect cells and the amount of virus was collected 12, 24, and 48 hours after transfection to further confirm the antiviral activity.

[0143] In order to determine whether there are differences in the silencing effects of small interfering RNAs on different subtypes of FMDV, this example uses the same small interfering RNA to detect its silencing effects on three subtypes of O, A, and Asia I. BHK-21 cells were transiently transfected with blank transfection and small interfering RNA (2.5nmol), and then according to the method in Example 1, 100TCID50 / 0.1ml of FMDV FMO, FMA and FMAsia (Asia I subtype) were added respectively. Infect. Studies have shown that the virus production in BHK-21 cells transfected with small interfering RNA is significantly reduced from the beginning of infection until 48 hours after infection. Therefore, small interfering RNAs have silencing effects o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a spraying agent containing small molecule interfering RNA, which is designed aiming at the highly conserved sequence of viral genome transmitted through a respiratory tract and encapsulated by liposome for increasing bioavailability thereof. The spraying agent can be applied in subjects infected or possibly infected with virus in surrounding areas in a window period of viral infection so as to effectively inhibit proliferation of the virus, stop spreading of the virus or prevent diseases caused by the virus, and induce spontaneous immune response. The spraying agent has the advantages of high bioavailability, low side effects, low cost, and convenient use.

Description

technical field [0001] The invention belongs to the application field of bioengineering technology, and in particular relates to a spray containing small molecule interference ribonucleic acid. Background technique [0002] Post-transcriptional gene silencing, which existed early in a few plants, was considered a rather peculiar phenomenon. But in recent years it has become a hot topic in molecular biology. In 1995, Guo and Kemphues found that double-stranded DNA (dsDNA) can induce gene silencing in C.elegans. In 1998, Andy Fire and Craig Mello also discovered the same phenomenon in worms, and officially used the term RNA interference (RNAi) in the gene silencing mechanism. In 2001, Tom Tuschl's research group discovered that a small interfering RNA (small interfering RNAs, siRNA) can cause gene silencing in mammalian cells. The discovery of this gene-specific degradation phenomenon in mammals provides new powerful tools for functional genomics research and opens up new a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K9/12A61K48/00A61K9/127A61P31/16A61P31/12
Inventor 祝加贝
Owner 祝加贝