Check patentability & draft patents in minutes with Patsnap Eureka AI!

Avid kyowamycin genetic engineering bacterium and use thereof

A technology of Streptomyces avermitilis and genetically engineered bacteria, which is applied in the field of microbial fermentation and genetic engineering, can solve the problems of low fermentation unit and high production cost, and achieve the effect of reducing production cost and increasing output

Inactive Publication Date: 2009-03-18
CHINA AGRI UNIV
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the production strains of abamectin in my country still have low fermentation units and high production costs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Avid kyowamycin genetic engineering bacterium and use thereof
  • Avid kyowamycin genetic engineering bacterium and use thereof
  • Avid kyowamycin genetic engineering bacterium and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Embodiment 1, the construction of frr gene expression vector

[0023] 1. Construction of recombinant plasmid containing frr gene and its own promoter

[0024] 1. Amplification of the frr gene containing its own promoter

[0025] Design primers for PCR amplification of the frr gene [NC_003155.4(3224362...3223805)] located on the chromosome of Streptomyces avermitilis with its own promoter, and the upstream primer PrimerF1 (CCGACATGACCGCGATCAC) is located 300bp upstream of the frr start codon , downstream primer Primer R1 (CG GAATTC GTCATGCGCATCGTACGTGG, the underlined base is the restriction endonuclease EcoRI recognition site) is located 150 bp downstream of the frr stop codon, and the amplified product should be 976 bp.

[0026] Using the total DNA of Streptomyces avermitilis wild-type strain ACTT31267 as a template, PrimerF1 and Primer R1 as primers, PCR amplification was carried out, and the amplification conditions were 95°C, 4min; (95°C, 1min; 60°C, 1min; 72°C, ...

Embodiment 2

[0035] Embodiment 2, transformation of recombinant plasmid

[0036] A total of four expression plasmid vectors of frr genes were constructed through Example 1, namely pFR1-1139, pFR1-152, pFR4-1139 and pFR4-152, and the original plasmids used as controls were pKC1139 and pSET152. The characteristics of these six plasmids are briefly described (Table 1).

[0037] Table 1 Characteristics of recombinant plasmids containing frr gene and original plasmids

[0038]

[0039] Due to the strong restriction modification in Streptomyces avermitilis, the transformation efficiency of Streptomyces avermitilis is very low when using the plasmid extracted from E.coliDH5α to directly transform Streptomyces avermitilis, sometimes even no transformant can be obtained. However, the transformation efficiency of the plasmid from E.coli ET12567, a recipient strain without restriction modification, was significantly improved. Therefore, the constructed recombinant plasmids and control plasmids w...

Embodiment 3

[0042] Embodiment 3, the fermentation research of transformant

[0043] 1. Fermentation research of ATCC31267 and its transformants

[0044] 1. Shake Flask Fermentation of Streptomyces avermitilis

[0045] Seed medium: 30g soluble starch, 2g malt extract, 2g soybean peptone, CoCl 2 ·6H 2 O 5mg, add distilled water to 1L, adjust pH to 7.0-7.2.

[0046] Fermentation medium: 50g soluble starch, 12g yeast powder, MgSO 4 ·7H 2 O 0.5g, K 2 HPO 4 ·3H 2 O 0.5g, KCl4g; CaCO 3 2g, CoCl 2 ·6H 2 O 5mg, add distilled water to 1L, adjust pH to 7.0-7.2.

[0047] Streptomyces avermitilis wild-type strain ATCC31267 and its different transformants grow abundant spores on the YMS medium and inoculate them in the seed medium (loading capacity is 100mL / 500mL Erlenmeyer flask), and cultivate them in a shaker at 28°C for 24 hours ( Speed ​​180rpm, eccentricity 2.5cm). Inoculate in the fermentation medium (loading capacity is 50mL / 300mL Erlenmeyer flask) by 5% inoculation amount, cultiv...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a genetic engineering bacterium capable of improving the yield of abamectin, which is a recombinant bacterium over-expressed by ribosome circular factors obtained by the introduction of frr genes of the encoded ribosome circular factors in acitretin streptomycete into the acitretin streptomycete through an expression vector. The genetic engineering bacterium can be directly used for fermentation production of the abamectin and for improving the fermentation unit of the abamectin and reducing the production cost.

Description

technical field [0001] The invention relates to the field of microbial fermentation and genetic engineering, in particular to a genetically engineered bacterium capable of increasing the yield of abamectin, its construction method and its application in the production of abamectin. Background technique [0002] Abamectin is a group of high-efficiency insecticidal sixteen-membered ring macrolide antibiotics produced by Streptomyces avermitilis during fermentation. Its natural products have eight components (A1a, A1b, A2a) , A2b, B1a, B1b, B2a, B2b), wherein the B1 component has the strongest insecticidal activity and is mainly used as an insecticide in agricultural production, resisting almost all nematodes and arthropods related to agriculture. The mechanism of action of avermectins is different from conventional chemical insecticides. They do not inhibit cholinesterase or protein synthesis, but are neurotransmitters of nematodes and arthropod parasites γ-aminobutyric acid (...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12P19/62C12R1/465
Inventor 文莹李丽莉陈芝宋渊李季伦
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More