Protective antigen composition capable of excitating organism to generate immunity against plague and use thereof

A protective antigen and composition technology, applied in the fields of application, bacterial antigen components, biochemical equipment and methods, etc., can solve the problem that the F1 antigen cannot represent the full virulence of Yersinia pestis

Inactive Publication Date: 2009-03-25
MICROBE EPIDEMIC DISEASE INST OF PLA MILITARY MEDICAL ACAD OF SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although newer vaccines based on F1 and V antigens are effective against both bubonic and pneumonic plague, the F1 antigen cannot represent the full virulence of Yersinia pestis (Titball RW, Williamson ED: Yersinia pestis(plague) vaccines. Expert Opin Biol Ther 2004, 4(6): 965-973.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protective antigen composition capable of excitating organism to generate immunity against plague and use thereof
  • Protective antigen composition capable of excitating organism to generate immunity against plague and use thereof
  • Protective antigen composition capable of excitating organism to generate immunity against plague and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1. Preparation of untagged rV270 antigenic protein using pET28a and thrombin Xa factor

[0049] 1. Primer design

[0050] According to the nucleotide sequence of Yersinia pestis LcrV gene, design and synthesize a pair of oligonucleotide primers with factor Xa restriction site, the upstream primer is: 5-CGCG GATCC ATCGAAGGTCGTATGATTAGAGCCTACGAAC (the underlined part is the BamHI restriction site, the italicized part is the Xa factor restriction site, sequence 2 in the sequence table); the downstream primer is: 5-CCGGCC AAGCTT TTAGGCAAAGTGAGATAATTC (the underlined part is the HindIII restriction site, sequence 3 in the sequence listing).

[0051] 2. Amplification of rV270 gene

[0052] Use Yersinia pestis DNA (20ng) as template, 1 μl of upstream and downstream primers (5 μM) in step 1, 3 μl of dNTP (10 μM), 3 μl of 10×buffer, 0.2 μl of Taq DNA polymerase (5U / μl), add sterile deionized water to a total volume of 30 μl. The amplification conditions were: pre-d...

Embodiment 2

[0066] Example 2, Utilizing pET28a and enterokinase to prepare untagged rV270 antigenic protein

[0067] 1. Primer design

[0068] According to the nucleotide sequence of Yersinia pestis LcrV gene, design and synthesize a pair of oligonucleotide primers with enterokinase restriction site, the upstream primer is: 5-CGG GGTACC GACGACGACGACAAGATGATTAGAGCCTACGAAC (the underlined part is the Kpn I restriction site, the italic bold part is the enterokinase restriction site, sequence 4 in the sequence table); the downstream primer is: 5-CG GAATTC TTAGGCAAAGTGAGATAATTC (the underlined part is the restriction site of EcoR I, sequence 5 in the sequence listing).

[0069] 2. Amplification of rV270 gene

[0070] Use Yersinia pestis DNA (20ng) as template, 1 μl of upstream and downstream primers (5 μM) in step 1, 3 μl of dNTP (10 μM), 3 μl of 10×buffer, 0.2 μl of Taq DNA polymerase (5U / μl), add sterile deionized water to a total volume of 30 μl. The amplification conditions were: pre...

Embodiment 3

[0084] Example 3: Determination of Antibody Titers and Evaluation of Protective Effects of Mice Immunized with the Protective Antigen Composition of the Present Invention that Can Stimulate the Body's Immunity to Plague

[0085] 1. Extraction and purification of natural F1 antigen of Yersinia pestis EV76 vaccine strain

[0086] Taking the Yersinia pestis EV76 vaccine strain as an example, the following method is used to extract and purify the natural F1 antigen from the Yersinia pestis EV76 vaccine strain, including the following steps:

[0087] 1. Cultivation of Yersinia pestis EV76 vaccine strain

[0088] The Yersinia pestis EV76 vaccine strain (purchased from Lanzhou Institute of Biological Products) was inoculated into 5 mL of heart-brain infusion medium (purchased from BD Company, dissolve 37g of medium in 1L of pure water), culture at 37°C (35-40°C is acceptable) for 24h, then take 300μl of bacterial liquid, and then inoculate into 2L with 0.2% (0.1-0.3% is acceptable) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention discloses a protective antigen composition which can motivate an organism to generate immunity to plague, and the application thereof in preparing a plague vaccine. The protective antigen composition is a composition which is mixed by a natural F1 antigen and an rV270 antigen according to the weight ration of 1-2 to 2-1. The immune protection effect of the composition is evaluated by animal experiments and the evaluation result shows that the protective antigen composition that is composed of the natural F1 antigen and the rV270 antigen performs good immune protection effect to the infection caused to mice, guinea pigs and rabbits by plague bacillus, has relatively high safety and can be used for preparing a subunit plague vaccine.

Description

technical field [0001] The present invention relates to a composition and its application, in particular to a protective antigen composition capable of stimulating immunity against plague and its application in preparation of plague vaccine. Background technique [0002] Plague is a severe infectious disease caused by Yersinia pestis. There are three types of human plague: bubonic plague, pneumonic plague, and septicemic plague. In recent years, the world's plague epidemic has been on the rise. In 2000, the World Health Organization listed plague as a re-emerging infectious disease (WHO: human plague in 1998 and 1999. weekly epidemiological record 2000, 75: 338-343.). In addition, Yersinia pestis is a potential biological warfare agent and bioterrorist agent. The United States has listed Yersinia pestis as one of the six biological agents most likely to be used by terrorists. The inactivated plague vaccine only has a certain protective effect against bubonic plague, and th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/24C07K1/14C12N15/31C12N15/70A61K39/02A61P31/04
Inventor 王效义祁芝珍张青雯任玲玲代瑞霞王棠吴本传王旺杨永海郭兆彪崔百忠王祖陨王虎杨瑞馥
Owner MICROBE EPIDEMIC DISEASE INST OF PLA MILITARY MEDICAL ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap