Supercharge Your Innovation With Domain-Expert AI Agents!

Recombinant clostridium and construction method and use thereof

A technology of Clostridium acetobutylicum, Clostridium acetobutylicum, applied in the directions of applications, botanical equipment and methods, microorganism-based methods, etc., can solve problems such as the ability to not have chemical synthesis competition

Inactive Publication Date: 2009-05-06
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current level of production still does not have the ability to compete with chemical synthesis, so further research is still needed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant clostridium and construction method and use thereof
  • Recombinant clostridium and construction method and use thereof
  • Recombinant clostridium and construction method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1, construct the Clostridium acetobutylicum expressing formate dehydrogenase

[0036] Formate dehydrogenase was amplified from the genome of Candida boidinii 2.2160 (China Common Microorganism Culture Collection Center) (http: / / www.cgmcc.net / index.php / Contents / search) genome (fdh), the primers for amplifying the fdh gene are as follows:

[0037] fdh-A: AGTGTCGACAGGTGCTGTCAATGTGGT;

[0038] fdh-B: AGTGGATCCGTGCTCCCGTCATTATCT.

[0039]The PCR amplification product was connected to the expression vector pIMP1 (Mermelstein, L.D., N.E.Welker, G.N.Bennett, and E.T.Papoutsakis.(1992).Expression of cloned homologousfermentative genes in Clostridium acetobutylicum ATCC 824.Bio / Technology.10:190-195) ( On the Institute of Microbiology, Chinese Academy of Sciences), the recombinant expression vector pITF ( figure 1 ), sequence verification after connection transformation, and the sequencing results showed that the nucleotide sequence of the PCR product of the amplif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant clostridium, a method for constructing the same and application thereof. The method for constructing the recombinant clostridium is to introduce a gene for encoding formic dehydrogenase into a clostridium to construct a recombinant bacterium. The clostridium is an acetone butanol clostridium or a clostridium beijerinckii. The invention also discloses a method for producing butanol, which is to ferment and culture the recombinant bacterium constructed by the method for constructing the recombinant clostridium to produce the butanol. The yield of butanone produced through fermenting the recombinant acetone butanol clostridium constructed by the invention can reach as high as 14.1 grams per liter.

Description

technical field [0001] The invention relates to a recombinant clostridium and its construction method and application. Background technique [0002] The non-renewability and limited storage of fossil energy is a major problem facing modern society. This has led to an upward trend in crude oil prices, which has placed a heavy burden on the country's economic development. The extensive use of fossil fuels has also brought about serious environmental problems. The burning of fossil fuels dramatically increases the amount of carbon dioxide in the atmosphere, causing the greenhouse effect and warming the global climate. In addition, the sulfide and nitrogen compounds emitted during the combustion of fossil fuels lead to acid rain on a large scale and damage the environment. Therefore, there is an urgent need to seek alternative and environmentally friendly renewable fuels. Biomass is an inexhaustible resource in nature, which is renewable and will not emit more carbon dioxide...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/53C12N9/04C12P7/16C12R1/145
Inventor 王少华张延平董红军李寅
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com