Application of human heparinase cDNA expression vector in preparing anti human heparinase immune antibody
A technology for expressing vectors and immune antibodies, which is applied in the field of preparation of anti-human heparinase immune antibodies, and achieves the effect of broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Embodiment 1, the acquisition of anti-human heparanase antibody
[0048] 1. Cloning of human heparanase cDNA and construction of eukaryotic expression vector
[0049] The full-length cDNA of human heparanase gene is 1632bp, encoding 543 amino acid residues (Vlodavsky I, Friedmann, Y, Elkin M, et al Mammalian heparanase: gene cloning, expression and function in tumor progression and metastasis Nat Med, 1999, 5: 793-802). Purify the total RNA from the liver cancer cell line, then synthesize its cDNA by reverse transcription, and then use this cDNA template to design primers for cloning its full-length cDNA according to the full-length cDNA sequence of the human heparanase gene reported in the literature, and use the primers Introducing EcoR I and Xba I restriction sites, the primer sequences are gccggaattatgctgctgcgctcgaagc and cggtctagatcagatgcaagcagca. Then, the full-length cDNA of human heparanase gene was obtained by PCR method. The PCR reaction conditions were as f...
Embodiment 2
[0069] Embodiment 2, use the ELISA kit that contains anti-human heparanase immune antibody to detect the human heparanase level in the sample
[0070] 1. Preparation of ELISA kit containing anti-human heparinase immune antibody
[0071] The anti-human heparanase immune antibody prepared in Example 1, the commercialized rabbit anti-human heparanase antibody and the goat anti-rabbit IgG labeled with horseradish peroxidase as the second antibody were mixed with 0.75% chromogenic solution A. Hydrogen oxide solution, chromogenic solution B (0.1M phosphoric acid-citric acid buffer pH5.0, 1mg / mL tetramethylbenzidine solution 9:1)), washing solution PBST, blocking solution 10% calf serum, antibody dilution 0.1 gram of BSA was dissolved in 0.15M phosphate buffer (pH7.4) and packaged together to obtain an ELISA kit for detecting the level of human heparanase.
[0072] 2. Detection of human heparanase level
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 