Supercharge Your Innovation With Domain-Expert AI Agents!

Application of human heparinase cDNA expression vector in preparing anti human heparinase immune antibody

A technology for expressing vectors and immune antibodies, which is applied in the field of preparation of anti-human heparinase immune antibodies, and achieves the effect of broad application prospects

Inactive Publication Date: 2009-06-17
FIELD OPERATION BLOOD TRANSFUSION INST OF PLA SCI ACAD OF MILITARY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are no reports on the detection of heparanase levels in serum at home and abroad, and the detection of heparanase expression levels in tumor tissues is still in the research stage. Therefore, it is important to establish a sensitive method for the detection of heparanase levels.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of human heparinase cDNA expression vector in preparing anti human heparinase immune antibody
  • Application of human heparinase cDNA expression vector in preparing anti human heparinase immune antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Embodiment 1, the acquisition of anti-human heparanase antibody

[0048] 1. Cloning of human heparanase cDNA and construction of eukaryotic expression vector

[0049] The full-length cDNA of human heparanase gene is 1632bp, encoding 543 amino acid residues (Vlodavsky I, Friedmann, Y, Elkin M, et al Mammalian heparanase: gene cloning, expression and function in tumor progression and metastasis Nat Med, 1999, 5: 793-802). Purify the total RNA from the liver cancer cell line, then synthesize its cDNA by reverse transcription, and then use this cDNA template to design primers for cloning its full-length cDNA according to the full-length cDNA sequence of the human heparanase gene reported in the literature, and use the primers Introducing EcoR I and Xba I restriction sites, the primer sequences are gccggaattatgctgctgcgctcgaagc and cggtctagatcagatgcaagcagca. Then, the full-length cDNA of human heparanase gene was obtained by PCR method. The PCR reaction conditions were as f...

Embodiment 2

[0069] Embodiment 2, use the ELISA kit that contains anti-human heparanase immune antibody to detect the human heparanase level in the sample

[0070] 1. Preparation of ELISA kit containing anti-human heparinase immune antibody

[0071] The anti-human heparanase immune antibody prepared in Example 1, the commercialized rabbit anti-human heparanase antibody and the goat anti-rabbit IgG labeled with horseradish peroxidase as the second antibody were mixed with 0.75% chromogenic solution A. Hydrogen oxide solution, chromogenic solution B (0.1M phosphoric acid-citric acid buffer pH5.0, 1mg / mL tetramethylbenzidine solution 9:1)), washing solution PBST, blocking solution 10% calf serum, antibody dilution 0.1 gram of BSA was dissolved in 0.15M phosphate buffer (pH7.4) and packaged together to obtain an ELISA kit for detecting the level of human heparanase.

[0072] 2. Detection of human heparanase level

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel use of a human heparanase cDNA expression vector that is the application in preparation of the human heparanase immune antibody. The human heparanase cDNA expression vector is a recombinant vector containing a human heparanase complete coding cDNA. The detection results show that the immune serum obtained by the human heparanase cDNA expression vector in the invention has an immunological characteristics aiming at the heparanase, the purified anti-human heparanase immune antibody can be used in the scientific research and clinic such as the human blood serum, the qualitative and quantitative detection of the heparanase in a tumour tissue and is useful for the clinic diagnosis and prognosis judgement of the relative disease. The human heparanase cDNA expression vector plays important roll in the preparation of the anti-human heparanase immune antibody and the medicine field and has a wide application prospect.

Description

technical field [0001] The invention relates to a new application of a human heparanase cDNA expression vector, in particular to the application of the human heparanase cDNA expression vector in preparing anti-human heparanase immune antibodies. Background technique [0002] Heparan sulfate, a linear anionic glycosaminoglycan, widely exists on the surface of various cells and mediates the interaction between proteins, such as participating in the binding of cytokines (FGF-1, 2, HGF, TGFβ, PDGF) to receptors , regulates the interaction between antithrombin and thrombin, and is also an important component of the intercellular matrix and subendothelial basement membrane. In the process of tumor formation, the extracellular matrix wraps the tumor and normal tissue, and the basement membrane under the vascular endothelium constitutes a physiological barrier to prevent tumor invasion and hematogenous metastasis to adjacent tissues. [0003] Heparanase—beta-1,4 endoglucosidase, sp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C07K16/40C07K16/06G01N33/573G01N33/543
Inventor 宫锋宋海峰李素波高新高红伟田曙光虞立霞檀英霞
Owner FIELD OPERATION BLOOD TRANSFUSION INST OF PLA SCI ACAD OF MILITARY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More