Reagent kit for detecting porcine reproductive and respiratory syndrome virus and detecting method
A technology for respiratory syndrome and detection kits, which is applied in biochemical equipment and methods, microbe determination/inspection, DNA/RNA fragments, etc. It can solve problems such as lack of detection methods, achieve high sensitivity, and facilitate rapid The effect of detecting and avoiding large-scale infection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0028] Primer design and preparation
[0029] Refer to GenBank to find multiple strains, perform sequence comparison, and design three pairs of relatively conservative specific primers according to the comparison results. The primer sequences are as follows:
[0030] The primer sequence of the 490bp band is:
[0031] Upstream primer CCCCGCCAACCCCGAGAATAG (SEQ ID NO: 1)
[0032] Downstream primer AATCCCAAAGCGTGCCATCAATCC (SEQ ID NO: 2)
[0033] The primer sequence of the 345bp band is:
[0034] The upstream primer is AGCCAGCCTTCGCCCTATCCAT (SEQ ID NO: 3)
[0035] The downstream primer is GAAACCCCGACCACCGCAACT (SEQ ID NO: 4)
[0036] The primer sequence of the 228bp band is:
[0037] The upstream primer is CCCGGGTTGAAAAGCCTCGTGT (SEQ ID NO: 5)
[0038] The downstream primer is GGCTTCTCCGGGTTTTTCTTCCTA (SEQ ID NO: 6)
[0039] The above primers were synthesized by Dalian Bao Biological Engineering Co., Ltd.
[0040] positive control
[0041] The positive control of the ki...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap