Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Reagent kit for detecting porcine reproductive and respiratory syndrome virus and detecting method

A technology for respiratory syndrome and detection kits, which is applied in biochemical equipment and methods, microbe determination/inspection, DNA/RNA fragments, etc. It can solve problems such as lack of detection methods, achieve high sensitivity, and facilitate rapid The effect of detecting and avoiding large-scale infection

Active Publication Date: 2009-06-24
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As we all know, RNA viruses have a high degree of variability, and PRRSV is a highly contagious virus, so the existing detection methods are not fast, sensitive and accurate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent kit for detecting porcine reproductive and respiratory syndrome virus and detecting method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0028] Primer design and preparation

[0029] Refer to GenBank to find multiple strains, perform sequence comparison, and design three pairs of relatively conservative specific primers according to the comparison results. The primer sequences are as follows:

[0030] The primer sequence of the 490bp band is:

[0031] Upstream primer CCCCGCCAACCCCGAGAATAG (SEQ ID NO: 1)

[0032] Downstream primer AATCCCAAAGCGTGCCATCAATCC (SEQ ID NO: 2)

[0033] The primer sequence of the 345bp band is:

[0034] The upstream primer is AGCCAGCCTTCGCCCTATCCAT (SEQ ID NO: 3)

[0035] The downstream primer is GAAACCCCGACCACCGCAACT (SEQ ID NO: 4)

[0036] The primer sequence of the 228bp band is:

[0037] The upstream primer is CCCGGGTTGAAAAGCCTCGTGT (SEQ ID NO: 5)

[0038] The downstream primer is GGCTTCTCCGGGTTTTTCTTCCTA (SEQ ID NO: 6)

[0039] The above primers were synthesized by Dalian Bao Biological Engineering Co., Ltd.

[0040] positive control

[0041] The positive control of the ki...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention relates to a reagent kit used for detecting porcine reproductive and respiratory syndrome virus and a detection method thereof. The reagent kit comprises a RNA enzyme inhibitor, AMV revertase, Taq enzyme, RNA-free enzyme solution, One Step RNA PCR mixed solution and a mixture of primers with negative control and sequence selected from SEQ ID NO: 1 to SEQ ID NO:6. The detection method comprises the step of using the reagent kit to carry out RT-PCR amplification. The method can detect the porcine reproductive and respiratory syndrome virus fast, sensitively and exactly with low cost.

Description

technical field [0001] The invention relates to a kit and a detection method for detecting porcine reproductive and respiratory syndrome virus, more particularly to a kit and a detection method for detecting porcine reproductive and respiratory syndrome virus by one-step RT-PCR. Background technique [0002] Porcine reproductive and respiratory syndrome (Porcine reproductive and respiratory syndrome, PRRS), also known as blue ear disease, is a new highly contagious pig disease, mainly manifested as early abortion, stillbirth, mummified fetus and weak birth in pregnant sows. Reproductive disorders such as piglets and respiratory symptoms in pigs of all ages, high mortality in piglets, and immune suppression in infected pigs. Since the disease was first discovered in the United States in 1987 and in Europe in 1990, it has spread to all pig-raising countries in the world. The recessive infection rate of this disease is high, and it breaks out periodically. According to statist...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
Inventor 刘湘涛田宏吴锦艳尚佑军尹双辉靳野
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products