Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Covalent factor VII-tissue factor complex

A coagulation factor and tissue factor technology, applied in the field of novel covalent complexes, can solve the problem of not showing proteolytic activity of coagulation factor X

Inactive Publication Date: 2009-06-24
NOVO NORDISK AS
View PDF37 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the cross-linked complex does not exhibit proteolytic activity towards coagulation factor X

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Covalent factor VII-tissue factor complex
  • Covalent factor VII-tissue factor complex
  • Covalent factor VII-tissue factor complex

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0112] Preparation of complex

[0113] Crosslinking Tissue Factor and Factor VII Using Heterobifunctional Reagents

[0114] In an interesting variant, the method for preparing the complex involves production of cysteine ​​variants of soluble tissue factor followed by labeling of soluble tissue factor with a heterobifunctional reagent in which one functional group is cysteine ​​reactive Cysteine, and finally cross-linked with factor VIIa through the second functional group of the reagent. Methods for cloning and expressing tissue factor cysteine ​​mutants in E. coli and subsequent labeling with cysteine-specific reagents have been previously described (Stone et al. (1995) Biochem. J., 310, 605-614; etc. (1996) Protein Sci., 5, 1521-1540; Owenius et al. (1999) Biophys.J., 77, 2237-2250; et al. (2001) Biochemistry, 40, 9324-9328). Photocrosslinking of proteins using heterobifunctional reagents comprising a cysteine-specific and a photoactivatable functional group has been de...

Embodiment 1

[0128]Materials - D-Phe-Phe-Arg-Chloromethylketone was purchased from Bachem. Chromogenic Z-D-Arg-Gly-Arg-p-nitroaniline (S-2765) and H-D-Ile-Pro-Arg-p-nitroaniline (S-2288) substrates were purchased from Chromogenix (Sweden). Human plasma-derived coagulation factor X (hFX), coagulation factor Xa (hFXa) and coagulation factor IXa (hFIXa) were purchased from EnzymeResearch Laboratories Ltd. (South Bend, IN). Human whole brain Marathon-ready cDNA library was purchased from Clontech (Mountain View, CA). According to published literature ( et al. (1996) Protein Sci., 5, 1531-1540) prepared soluble tissue factor 1-219 (sTF(1-219)) expressed in Escherichia coli. Recombinant Factor VIIa was expressed and purified as previously described (Thim et al. (1988) Biochemistry, 27, 7785-7793; Persson et al. (1996) FEBS Lett., 385, 241-243). All other reagents were of analytical grade or higher grade.

[0129] Construction of DNA encoding coagulation factor VII and coagulation factor VII...

Embodiment 2

[0156] Construction of DNA encoding sTF(1-219)W45C, sTF(1-219)D58C, sTF(1-219)G109C and sTF(1-219)P206C-by Site-directed mutagenesis sTF(1-219) mutants were constructed according to the protocol (Stratagene, La Jolla, CA) using the primer pairs (forward and reverse) listed in Table 3 and pHOJ356 as template. The correctness of all cloned sequences was verified by DNA sequencing.

[0157] Table 3 - Forward and reverse (oligo) primers for TF cDNA site-directed mutagenesis

[0158] Primer mutation Sequence (5'→3') oHOJ172-f W45C CACTAAGTCAGGAGATTGCAAAAGCAAATGCTTTTAC oHOJ172-r W45C GTAAAAGCATTTGCTTTTGCAATCTCCTGACTTAGTG oHOJ173-f D58C CAACAGACACAGAGTGTTGCCTCACCGACGAGATTG oHOJ173-r D58C CAATCTCGTCGGTGAGGCAACACTCTGTGTCTGTTG oHOJ174-f G109C CCTGGAGACAAAACCTCTGCCAGCCAACAATTCAGAG oHOJ174-r G109C CTCTGAATTGTTGGCTGGCAGAGGTTTGTCTCCAGG oHOJ175-f P206C GAAGAGTACAGACAGCTGCGTAGAGTGTATGGGC oHOJ175-r P206C GCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to novel covalent complexes of a Factor VII polypeptide and a Tissue Factor polypeptide, in particular to such complexes which are functionally active and which have an enhanced proteolytic activity towards Factor X compared to the corresponding free Factor VII polypeptide as well as methods for production of these novel complexes.

Description

field of invention [0001] The present invention relates to novel covalent complexes of Factor VII polypeptides and tissue factor polypeptides, in particular complexes having functional activity and enhanced proteolytic activity towards Factor X compared to the corresponding free Factor VII polypeptides. Such compounds are believed to be particularly useful in the treatment of bleeding disorders. Background of the invention [0002] The coagulation factor VIIa polypeptide with enhanced biological activity is a favorable molecule for the treatment of uncontrollable bleeding due to the suboptimal drug effect of recombinant coagulation factor VIIa, for which traditional recombinant coagulation factor VIIa therapy is partially or completely ineffective. Current approaches to enhancing efficacy mirror the mechanism of action of recombinant factor VIIa, which manifests itself as direct activation of factor X on activated platelets independent of tissue factor. [0003] Tissue fact...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/48C12N9/64C07K14/705C07K14/745
CPCC12Y304/21021C12N9/6437C07K14/745C07K14/70596A61P7/02
Inventor H·奥斯特加尔德O·H·奥尔森A·K·彼得森H·R·斯滕尼克
Owner NOVO NORDISK AS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com