Cultivated silkworm glutathione-S-transferase BmGSTe7 gene and uses thereof
A technology of glutathione and transferase, which is applied in the direction of transferase, genetic engineering, plant gene improvement, etc., can solve the problem that there is no anti-pesticide or anti-oxidation activity of silkworm
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment
[0037]Based on the predicted coding sequence (CDS) in the silkworm genome, we searched for EST evidence for the BmGSTe7 gene in the silkworm expressed sequence tag (EST) database, found 2 EST sequences, and spliced them with CDS and EST sequences Then design gene-specific primers; forward primer of BmGSTe7: 5'CATATGAGTCTAATGTTGTACAAACTA 3', reverse primer: 5'GGATCCTACATTTTAGATTAAGATCCA 3'; amplify with the designed specific primers in the fat body cDNA of silkworm 5 instar 3 as a template, The target band was obtained, the PCR product was recovered and ligated with the pMD18-T vector, transformed into DH5α competent cells, and the positive clone was obtained and sent to Shanghai Sangon for sequencing. The sequencing results showed that the amplified sequence was consistent with the expected result; pET28a, connected with T4 ligase and transformed into Bl21(DE3) competent cells, screened to obtain the clone containing pET28a-BmGSTe7, and cultured the single clone containing pE...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com