Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cultivated silkworm glutathione-S-transferase BmGSTe7 gene and uses thereof

A technology of glutathione and transferase, which is applied in the direction of transferase, genetic engineering, plant gene improvement, etc., can solve the problem that there is no anti-pesticide or anti-oxidation activity of silkworm

Inactive Publication Date: 2009-07-29
SOUTHWEST UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no research report on genes with anti-pesticide or anti-oxidative activity in silkworm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0037]Based on the predicted coding sequence (CDS) in the silkworm genome, we searched for EST evidence for the BmGSTe7 gene in the silkworm expressed sequence tag (EST) database, found 2 EST sequences, and spliced ​​them with CDS and EST sequences Then design gene-specific primers; forward primer of BmGSTe7: 5'CATATGAGTCTAATGTTGTACAAACTA 3', reverse primer: 5'GGATCCTACATTTTAGATTAAGATCCA 3'; amplify with the designed specific primers in the fat body cDNA of silkworm 5 instar 3 as a template, The target band was obtained, the PCR product was recovered and ligated with the pMD18-T vector, transformed into DH5α competent cells, and the positive clone was obtained and sent to Shanghai Sangon for sequencing. The sequencing results showed that the amplified sequence was consistent with the expected result; pET28a, connected with T4 ligase and transformed into Bl21(DE3) competent cells, screened to obtain the clone containing pET28a-BmGSTe7, and cultured the single clone containing pE...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a domestic silkworm glutathione-S-transferase BmGSTe7 gene. An organophosphorus resistance gene PxGST3 protein sequence of lepidoptera pest diamond back moth is adopted to carry out TBLASTN retrieval on a domestic silkworm genome to obtain a plurality of glutathione-S-transferase homologous genes, by comparison, the best domestic silkworm BmGSTe7 gene goes through cloning, expression, purification and detection of enzyme activity. Activity of an expression product on a mode substrate CDNB (1-chlorine-2, 4-dinitro benzene) is 15 mumol / min / mg protein. Medicine for preventing and treating the lepidoptera pest yet without toxicity and harm to beneficial insects of other items is expected to be designed by a gene target, therefore the gene of the invention is of great value in medicine development and pest control.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a silkworm glutathione-S-transferase BmGSTe7 gene derived from silkworms with anti-pesticide or anti-oxidation activity. Background technique [0002] Pesticides play a very important role in pest control, but with the use of a large number of pesticides, insect resistance is increasing day by day, forcing people to develop new pesticide products or increase the dosage of pesticides, which not only restricts economic development, but also gives The environment has brought a serious burden, which affects the sustainable development of economy and human beings. In addition, insect resistance to pesticides is often associated with insect antioxidation. For example, during the process of detoxifying and metabolizing organophosphorus pesticides, insects may produce some active oxygen and other substances, thereby inducing the oxidative stress response of insects. At the same time as resi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/10A01N63/02A01P7/04
Inventor 鲁成余泉友左伟东柴春利代方银潘敏慧
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com