Unlock instant, AI-driven research and patent intelligence for your innovation.

Porcine circovirus 2 LAMP detection kit and detecting method

A detection kit, porcine circovirus technology, applied in the field of disease diagnosis, can solve problems such as unseen

Inactive Publication Date: 2009-11-25
CHINA INST OF VETERINARY DRUG CONTROL
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no LAMP detection kit for the detection of porcine circovirus type 2 at home and abroad and the application of this method in the detection of porcine circovirus type 2

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine circovirus 2 LAMP detection kit and detecting method
  • Porcine circovirus 2 LAMP detection kit and detecting method
  • Porcine circovirus 2 LAMP detection kit and detecting method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] 1) Primer design According to the PCV2 strain sequence published by GenBank as a template, the following two pairs of primers were designed, the primer sequences:

[0085] PB1: ATCACAAGGACAACGGAGTG

[0086] PB2: GCCCCACAATGACGTGTAC

[0087] PB3: GCTCTGCAACGGTCACCAGAACCTCTACTGCTGTGAGT

[0088] PB4: TTGTCAGAAATTTCCGCGGGCTTTCGTCTTCCAATCACGCTT

Embodiment 2

[0090] Preparation of the components in the kit: Prepare various components (50 reaction volumes) according to the formula of the following components, and distribute them into small glass or plastic containers and seal them with corresponding stoppers:

[0091] 1. Viral DNA extraction (LBBI-DNA) reagent:

[0092] 1) DA: Dissolve 10ml of 1% 2-mercaptoethanol solution, 3ml of 10mmol / mL Tris-HCL (pH 8.0), 1ml of 10mmol / ml EDTA in sterilized double distilled water, set to 30ml, and put it into a nuclease-free plastic container .

[0093] 2) DB: 200mmol / ml 15ml NaOH and 15ml 1% SDS solution were mixed, fixedly dissolved in deionized water to 30ml, and put into a nuclease-free plastic container.

[0094]3) DC: 75ml absolute ethanol, pH 4.8 200mmol sodium acetate 1ml mixed and put into a plastic container.

[0095] 4) DD: Dissolve 50u of RNAseA in 100ml of nuclease-free water (DEPC), and put it into a nuclease-free plastic container.

[0096] 2. Preparation of the solution in the...

Embodiment 3

[0103] Use of PCV2LAMP Kit

[0104] 1. Extraction of sample DNA

[0105] Add 500μl DA to 100μl tested sample, vortex for 15s, centrifuge at 12000g for 1min, take the supernatant and put it in a new tube; add 300μl DB solution to the supernatant, vortex or vigorously shake for 90s; add an equal volume of DC solution , vortexed for 1 min, then centrifuged at 12000 g for 1 min, discarded the supernatant, left at room temperature for 5 min to dry the precipitate, added 10 μl DD and dissolved it into sample DNA.

[0106] 2. Preparation of reaction solution

[0107] Take 1.5 μl of PB, 12.5 μl of RB and 1.0 μl of EB, put them in a small reaction tube, add 5.5 μl of sample DNA, and mix well.

[0108] 3. The progress of the reaction

[0109] When the temperature of the LAMP Tubidimeter reached 65°C, the reaction tubes into which each component was added were placed in a constant temperature water bath at 65°C for isothermal amplification for 30 minutes.

[0110] 4. Result judgment ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a porcine circovirus 2 LAMP detection kit and detecting method. Based on the PCV2 gene sequence disclosed by GenBank, four PCV2 LAMP primers are designed in the sequence conservative region; the set PCV2 LAMPreaction system is adopted to conduct the LAMP reaction by taking the PCV2 HuB strain, PCV2LN strain virus DNA as a formwork. the LA-320 LAMP Tubidimeter is used for analyzing the added SYBRgreenI developer in the reaction process and after the reaction to judge the result, the result shows that the PCV2DNA has high-efficiency specificity amplification in LA-320 LAMP Tubidmeter at 63 DEG for 30 min, the SYBRgreenI developer is added to judge the result is consistent with the result displayed by the instrumental analysis. the sensitivity test proves that in the method, the 50ngPCV2 DNA formwork is diluted by 10, the efficient amplification still can be conducted, thus the method has high susceptibility. It shows that the method is special, simple and rapid, and is suitable for the PCV2 detecting work by the specificity test and the LAMP detecting of PVC2nucleic acid clinical sample.

Description

technical field [0001] The invention relates to a detection kit for porcine circovirus type 2 LAMP and a detection method thereof, and belongs to the disease diagnosis technology in the field of veterinary biological products. Background technique [0002] Porcine circovirus (Porcine circovirus, PCV) is the smallest virus found so far, which is divided into two subtypes, PCV1 and PCV2. Among them, PCV1 does not cause the disease, and PCV2 type can cause postweaning multisystemic wasting syndrome (Postweaning Multisystemic Wasting Syndrome, PMWS), and mixed infection is often found in pigs with porcine reproductive and respiratory syndrome caused by PRRSV. Infected pigs can excrete virus from excrement, and infect pigs of different ages through oral and respiratory routes. Vertical transplacental transmission of infected piglets from pregnant sows. Since there is no effective drug for treatment at present, the control of this disease is still based on prevention. [0003] ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68G01N21/78C12R1/93
Inventor 刘业兵张磊宁宜宝薛青红
Owner CHINA INST OF VETERINARY DRUG CONTROL