Method for measuring sortase based on yeast surface display
A technology of surface display and detection method, applied in the field of enzyme analysis, can solve the problems of high cost and complicated operation, and achieve the effect of low price, simple operation and cost reduction.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] A sorting enzyme detection method based on yeast surface display sorting enzyme substrate, which includes the following steps:
[0035] 1. According to the staphylococcus aureus sortase that can recognize the conserved motif LPXTG contained in the C-terminal sorting signal of the surface protein, pcDNA6-myc-his-EGFP is used as the template, and the primer is 5’-CCCACGCGTATG CAAGCTTTGCCTGAAACTGGTGAAG AA GGAGGAATTGGAATTGCTC-3’ and
[0036] 5’-CGCGAATTCTTACTTGTACAGCTCGTCCATG-3’, the underlined part is the substrate QALPETGEE gene, and the target gene QALPETGEE and linker-eGFP gene are fused to form QALPETGEE-linker-eGFP;
[0037] 2. Construction of QALPETGEE-linker-eGFP expression vector: The expression vector pKFS (modified pPIC9K, added flocculin gene, named pKFS, see the Chinese invention patent with application number 200810028631) and the target gene QALPETGEE-linker -eGFP was digested with double restriction enzymes to construct the vector pKFS-QALPETGEE-linker-eGFP. ...
Embodiment 2
[0044] A sorting enzyme detection method based on yeast surface display sorting enzyme substrate, which includes the following steps:
[0045] 1. According to the staphylococcus aureus sortase that can recognize the conserved motif LPXTG contained in the C-terminal sorting signal of the surface protein, pcDNA6-myc-his-EGFP is used as the template, and the primer is 5’-CCCACGCGTATG CAAGCTTTGCCTGAAACTGGTGAAG AA GGAGGAATTGGAATTGCTC-3’ and
[0046] 5’-CGCGAATTCTTACTTGTACAGCTCGTCCATG-3’, the underlined part is the substrate QALPETGEE gene, and the target gene QALPETGEE and linker-eGFP gene are fused to form QALPETGEE-linker-eGFP;
[0047] 2. Construction of QALPETGEE-linker-eGFP expression vector: The expression vector pKFS (modified pPIC9K, added the flocculin gene, named pKFS, see the Chinese invention patent with application number 200810028631) and the target gene QALPETGEE-linker -eGFP was digested with double restriction enzymes to construct the vector pKFS-QALPETGEE-linker-eG...
PUM
| Property | Measurement | Unit |
|---|---|---|
| fluorescence | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 