Padlock probe for detecting Acidovorax avenae subsp.citrulli and detection method
A fruit spot bacteria and probe detection technology is applied in the biological field to achieve the effects of avoiding false positives, strong specificity and reliable detection methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1: A molecular detection method using a padlock probe for detecting the bacterial fruit spot of melons.
[0042] Sequences of padlock probes for the detection of Bacteria fruit spot of melons:
[0043] P-a.a.c: CGGCACGGTGCAGTTTCCTGCTTTCCGCGC P I P 2 CCTTACGCTAGGTCGAGAGT ATTTTTGTCACCGG
[0044] (1) Ligation reaction solution includes: 20mM Tris-HCL, pH 9.0, 25mM KCH 3 COO, 10mM Mg (CH 3 COO) 2 , 10mM DTT, 1mM NAD, 0.1% Triton X-100, 2.4 U Taq DNA ligase, 1μl template to be tested, 100pm probe P-a.a.c. The ligation reaction program is: pre-denaturation at 95°C for 5 minutes; then cycle, denaturation at 95°C for 30 seconds, ligation at 65°C for 5 minutes, and a total of 20 cycles of reaction; then inactivation at 95°C for 15 minutes. Use exonuclease to excise self-ligated and mis-ligated probes: add 2 units of exonuclease I and 2 units of exonuclease III to the ligated product, react at 37°C for 2 hours, Then the reacted product was inactivated at 95° C....
example 1
[0047] Example 1 detects melon bacterial fruit spot bacterium from commercially available Hami melon seeds
[0048] The padlock detection probe and detection method of the above-mentioned melon bacterial fruit spot pathogen detect commercially available Hami melon seeds, including:
[0049] 1) Referring to the method of Walcott (2000), the commercially available cantaloupe seed suspension was used as a template.
[0050]2) Referring to the above technical scheme, use padlock detection probe P-a.a.c combined with Macroaary to detect samples. See the test results Figure 4 . The results showed that 4 of the 6 samples of Hami melon seeds in the market were detected to carry the bacterial fruit spot of melons. It is proved that the above technical scheme can be applied to the actual detection of melon bacterial fruit spot disease.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap