Check patentability & draft patents in minutes with Patsnap Eureka AI!

Padlock probe for detecting Acidovorax avenae subsp.citrulli and detection method

A fruit spot bacteria and probe detection technology is applied in the biological field to achieve the effects of avoiding false positives, strong specificity and reliable detection methods

Inactive Publication Date: 2009-12-23
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no examples of applying padlock probes to the actual detection of plant pathogens

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Padlock probe for detecting Acidovorax avenae subsp.citrulli and detection method
  • Padlock probe for detecting Acidovorax avenae subsp.citrulli and detection method
  • Padlock probe for detecting Acidovorax avenae subsp.citrulli and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: A molecular detection method using a padlock probe for detecting the bacterial fruit spot of melons.

[0042] Sequences of padlock probes for the detection of Bacteria fruit spot of melons:

[0043] P-a.a.c: CGGCACGGTGCAGTTTCCTGCTTTCCGCGC P I P 2 CCTTACGCTAGGTCGAGAGT ATTTTTGTCACCGG

[0044] (1) Ligation reaction solution includes: 20mM Tris-HCL, pH 9.0, 25mM KCH 3 COO, 10mM Mg (CH 3 COO) 2 , 10mM DTT, 1mM NAD, 0.1% Triton X-100, 2.4 U Taq DNA ligase, 1μl template to be tested, 100pm probe P-a.a.c. The ligation reaction program is: pre-denaturation at 95°C for 5 minutes; then cycle, denaturation at 95°C for 30 seconds, ligation at 65°C for 5 minutes, and a total of 20 cycles of reaction; then inactivation at 95°C for 15 minutes. Use exonuclease to excise self-ligated and mis-ligated probes: add 2 units of exonuclease I and 2 units of exonuclease III to the ligated product, react at 37°C for 2 hours, Then the reacted product was inactivated at 95° C....

example 1

[0047] Example 1 detects melon bacterial fruit spot bacterium from commercially available Hami melon seeds

[0048] The padlock detection probe and detection method of the above-mentioned melon bacterial fruit spot pathogen detect commercially available Hami melon seeds, including:

[0049] 1) Referring to the method of Walcott (2000), the commercially available cantaloupe seed suspension was used as a template.

[0050]2) Referring to the above technical scheme, use padlock detection probe P-a.a.c combined with Macroaary to detect samples. See the test results Figure 4 . The results showed that 4 of the 6 samples of Hami melon seeds in the market were detected to carry the bacterial fruit spot of melons. It is proved that the above technical scheme can be applied to the actual detection of melon bacterial fruit spot disease.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a padlock probe for detecting Acidovorax avenae subsp.citrulli and a detection method, belonging to the fields of disease prevention and treatment of crops and quarantine of plants. A padlock probe sequence P-a.a.c for detecting the Acidovorax avenae subsp.citrulli is CGGCACGGTGCAGTTTCCTGCTTTCCGCPIP2CCTTACGCTAGGTCGAGAGTATTTTTGTCACCGG. The detection method combined with a Macroaary technique on the basis of the probe has strong specialty, sensitivity and stability; and a rapid, sensitive and special method is provided for detecting the Acidovorax avenae subsp.citrulli. The figure shows the detecting result of the padlock probe detecting the Acidovorax avenae subsp.citrulli.

Description

(1) Technical field [0001] The invention relates to a padlock probe for detecting Acidovorax avenae subsp. citrulli and a detection method thereof, belonging to the field of biotechnology. Suitable for port inspection and quarantine, agricultural production, plant protection and other departments. (2) Background technology [0002] Cucurbit bacterial fruit spot is a devastating bacterial disease on Cucurbitaceae plants. Since the disease occurred in Florida, Indiana and Delaware in the United States in 1989, the disease has continued to spread to 15 states in the United States. Now it is mainly distributed in the United States, Australia, Mariana Islands, Indonesia, Turkey and other countries (Langston et al, 1999). Some provinces in my country have also reported the occurrence and harm of melon bacterial fruit spot disease, which has caused huge losses to fruit farmers. In order to prevent the damage and spread of the disease, my country listed it as a national agricultur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/01
Inventor 胡白石田艳丽刘凤权王源超郑小波
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More