Unlock instant, AI-driven research and patent intelligence for your innovation.

Establishing method of non-antibiotic resistance selecting and marking system based on QAPRTase gene and application

A technology for antibiotic resistance and gene selection, applied in the field of bioengineering, can solve problems such as the research and development of non-antibiotic resistance selection systems that have not been seen, and achieve the effect of stable transgenic plasmid strains and high plasmid copy number

Inactive Publication Date: 2012-06-06
ZHEJIANG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the QAPRTase gene is a known biochemical metabolic enzyme with published sequences and clear functions involved in NAD synthesis, there has been no research and development of non-antibiotic resistance selection systems using QAPRTase genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Establishing method of non-antibiotic resistance selecting and marking system based on QAPRTase gene and application
  • Establishing method of non-antibiotic resistance selecting and marking system based on QAPRTase gene and application
  • Establishing method of non-antibiotic resistance selecting and marking system based on QAPRTase gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1. Construction of Escherichia coli strain BW25113ΔQAPRTase with QAPRTase gene knockout

[0039] The QAPRTase gene on the genome of the strain BW25113 was knocked out using the Red recombination system. The BW25113 strain, pKD46 plasmid, pKD13 plasmid and pCP20 plasmid in the experiment were all purchased from the Yale CGSC E. coli Collection Center. The experimental procedure is as follows:

[0040] (1) Prepare competent cells for electrotransformation of BW25113 strain by conventional methods, and electrotransform competent cells with pKD46 plasmid, and the electroporation parameters are 2500V, 6ms; apply the bacterial solution after recovery culture to LB plates (containing 50 μg / mL of Amp ), cultured at 30°C until a single colony was formed.

[0041] (2) Select Amp from the tablet R Single colonies were cultured in LB liquid medium containing 50 μg / mL Amp and 1 mM L-arabinose until OD 600 Prepare electroporation competent cells at about 0.3.

[0042] (3) ...

Embodiment 2

[0053] Embodiment 2, the construction of non-antibiotic resistance plasmid vector

[0054] Based on the three plasmids pUC19, pBAD-hisA and pCDNA3.1+, which respectively represent T vector, prokaryotic expression plasmid and eukaryotic expression plasmid, the QAPRTase gene of Escherichia coli BW25113 and the QAPRTase gene of mouse were used to replace these three plasmids. Antibiotic resistance genes in a base plasmid.

[0055] 1. Construction of a plasmid that replaces the antibiotic resistance gene on the pUC19 plasmid with the Escherichia coli QAPRTase gene

[0056] (1) PCR amplification of basic plasmid sequences except antibiotic resistance genes. Using the pUC19 plasmid as a template, a pair of primers were designed, and MluI and XhoI restriction sites were respectively introduced at the 5' ends of the primers. The sequences of the designed primers were as follows:

[0057] F: CCGACGCGTACTCTTTCCTTTTCAATA

[0058] R: CCGCTCGAGCTGTCAGACCAAGTTTAC

[0059] The PCR system...

Embodiment 3

[0104] Embodiment 3, the comparison of antibiotic selection system and QAPRTase selection system of the present invention

[0105] 1. Comparison of transformation efficiency between antibiotic selection system and QAPRTase selection system

[0106] 0.1 μg of pUC19, pZJU11, pZJU12, pBAD-hisA, pZJU21, pZJU22, pCDNA3.1+, pZJU31, pZJU32 plasmids were respectively transformed into BW25113ΔQAPRTase, and the bacterial solution after recovery culture was spread on the plate. Among them, pUC19, pBAD-hisA and pCDNA3.1+ were coated on LB plates (containing 50 μg / mL Amp), and the other six plasmids were coated on M9 plates. After culturing at 37°C until a single colony appeared, the transformation efficiency was counted. see results figure 1 , when the antibiotic resistance gene on the plasmid was replaced with the QAPRTase gene of bacterial origin, its transformation efficiency was not inferior to that of the original plasmid. When the antibiotic resistance gene on the plasmid was rep...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of QAPRTase gene. The application comprises the following steps of: based on the function of QAPRTase enzyme, replacing antibiotic resistance gene in plasmid with QAPRTase gene and constructing a non-antibiotic resistance selecting and marking system based on the QAPRTase gene. The invention also provides a non-antibiotic resistance gene selecting carrier simultaneously, which replaces antibiotic resistance gene in plasmid carrier with QAPRTase gene. The invention also provides an establishing method of the non-antibiotic resistance selecting and markingsystem and an application of non-antibiotic resistance gene selecting carrier simultaneously, comprising the steps of: preparing non-antibiotic cloning vector, preparing non-antibiotic resistance prokaryotic expression plasmid, preparing non-antibiotic resistance eukaryotic expression plasmid and preparing non-antibiotic DNA vaccine.

Description

technical field [0001] The invention belongs to the technical field of bioengineering and relates to the establishment and application of a QAPRTase gene-based non-antibiotic resistance selection marker system. Background technique [0002] Plasmids have the characteristics of small molecular weight, circular shape, and easy operation. The existence of plasmids is beneficial for hosts to adapt to certain adversities. The most common feature of plasmids is to provide the host with antibiotic resistance genes, thereby improving the host's ability to survive in a specific environment. The screening system using antibiotic resistance genes as selectable markers endows host cells with the ability to survive on the medium containing the corresponding antibiotics. This feature not only prevents the shedding or loss of plasmids, but also brings convenience to the screening of plasmids. Therefore, this system is used in genetic engineering. It has been widely used in research. [0...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N15/63C12N15/70C12N15/74C12N15/79A61K48/00A61P39/00C12R1/19
Inventor 邵健忠董伟仁项黎新
Owner ZHEJIANG UNIV