Supercharge Your Innovation With Domain-Expert AI Agents!

Oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, preparation method and application thereof

A technology for Mycobacterium tuberculosis and oligonucleotides, applied in microorganism-based methods, biochemical equipment and methods, analytical materials, etc., can solve the problems of low sensitivity, low positive rate, and lack of clinical evaluation of large sample volumes. , to achieve the effect of improving accuracy and low cost

Inactive Publication Date: 2010-01-06
THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY +1
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among the diagnostic methods routinely used in clinical practice at present, the sensitivity of clinical specimen smear detection is low, and the positive rate is only 20-30%; the positive rate of traditional Roche culture is low, only about 30%, and it takes 4-8 weeks
The serological diagnosis of tuberculosis is mainly the detection of tuberculosis antibodies and antigens, and the detection of anti-tuberculosis antibodies is only an auxiliary diagnostic method. However, the detection sensitivity of tuberculosis antigen in body fluid samples is still low, and the main problems are as follows: ① Lack of high-titer specific antibodies. Although foreign countries have used specific tuberculosis antigens to immunize animals in recent years, and purified highly effective The research reports on antibodies are basically small sample size studies, lacking clinical evaluation of large sample size; There are certain limitations in the selection of target-specific antigens; ③The amount of Mycobacterium tuberculosis antigens in serum is low. Antigens combine with corresponding antibodies in vivo to form circulating immune complexes (CIC), which limits the sensitivity of antigen detection in serum
But so far, there are no reports about the Mycobacterium tuberculosis secreted antigen Ag85B aptamer and the application of oligonucleotide aptamer to detect tuberculosis antigen at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, preparation method and application thereof
  • Oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, preparation method and application thereof
  • Oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] A method for preparing an oligonucleotide aptamer targeting Mycobacterium tuberculosis Ag85B, the steps are as follows:

[0038] (1) Construction of a random single-stranded DNA (ssDNA) library and primers: construction of a random single-stranded DNA (ssDNA) library and primers: a random single-stranded DNA (ssDNA) library: 5'-GCAATGGTACGGTACTTCC(N35)CAAAAGTGCACGCTACTTTGCTAA-3'; Upstream primer: 5′-GCAATGGTACGGTACTTCC-3′; Downstream primer: 5′-GCTAAGCGGGTGGGACTTCCTAGTCCCACCCGCTTAGCAAAGTAGCGTGCACTT TTG-3′; Biotin-labeled upstream primer: 5′-biotin-GCAATGGTACGGTACTTCC-3′; the random single-stranded DNA (ssDNA) library and primers are synthesized by the primer company;

[0039] (2) PCR amplification preparation of random single-stranded DNA (ssDNA) library:

[0040] Amplify the ssDNA library into a dsDNA library, save it, and use the dsDNA library as a template to amplify the ssDNA library for the next round of screening:

[0041] The first round of amplification condit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses an oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, a preparation method and application thereof. The oligonucleotides aptamer has nucleotide sequences shown as AP-1 to AP-13. The preparation method of the oligonucleotides aptamer comprises steps as follows: (1) constructing a random single-stranded DNA (ssDNA) library and preparing a primer; (2) preparing the random single-stranded DNA (ssDNA) library by PCR amplification; (3) carrying out SELEX screening; (4) detecting the appetency; (5) cloning and sequencing DNA. The oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B is applied to detect the antigen level of the mycobacterium tuberculosis Ag85B in human serum, can replace antibodies, improves the sensitivity and the specificity of the tuberculosis antigen detection in specimens of body fluid (such as serum, hydrothorax, cerebrospinal fluid ascites and the like), thereby improving the accuracy rate of tuberculosis diagnosis.

Description

technical field [0001] The invention relates to an oligonucleotide aptamer targeting Mycobacterium tuberculosis Ag85B and its preparation method and application, belonging to the technical field of tuberculosis medical immunology and detection. Background technique [0002] The tuberculosis epidemic and drug resistance in my country are quite serious, and the number of tuberculosis patients ranks second in the world, second only to India. There are 4.51 million pulmonary tuberculosis patients, including 1.96 million infectious pulmonary tuberculosis patients, 1.4 million new tuberculosis cases and 130,000 annual deaths, ranking first among infectious diseases. Among the diagnostic methods routinely used in clinical practice at present, the sensitivity of clinical specimen smear detection is low, and the positive rate is only 20-30%; the positive rate of traditional Roche culture is low, only about 30%, and it takes 4-8 weeks. The serological diagnosis of tuberculosis is mai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12P19/34C12Q1/68G01N33/543C12R1/32C12N15/115
Inventor 吴雪琼王博阳幼荣张俊仙梁艳傅瑜
Owner THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More