Oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, preparation method and application thereof
A technology for Mycobacterium tuberculosis and oligonucleotides, applied in microorganism-based methods, biochemical equipment and methods, analytical materials, etc., can solve the problems of low sensitivity, low positive rate, and lack of clinical evaluation of large sample volumes. , to achieve the effect of improving accuracy and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] A method for preparing an oligonucleotide aptamer targeting Mycobacterium tuberculosis Ag85B, the steps are as follows:
[0038] (1) Construction of a random single-stranded DNA (ssDNA) library and primers: construction of a random single-stranded DNA (ssDNA) library and primers: a random single-stranded DNA (ssDNA) library: 5'-GCAATGGTACGGTACTTCC(N35)CAAAAGTGCACGCTACTTTGCTAA-3'; Upstream primer: 5′-GCAATGGTACGGTACTTCC-3′; Downstream primer: 5′-GCTAAGCGGGTGGGACTTCCTAGTCCCACCCGCTTAGCAAAGTAGCGTGCACTT TTG-3′; Biotin-labeled upstream primer: 5′-biotin-GCAATGGTACGGTACTTCC-3′; the random single-stranded DNA (ssDNA) library and primers are synthesized by the primer company;
[0039] (2) PCR amplification preparation of random single-stranded DNA (ssDNA) library:
[0040] Amplify the ssDNA library into a dsDNA library, save it, and use the dsDNA library as a template to amplify the ssDNA library for the next round of screening:
[0041] The first round of amplification condit...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap